We narrowed to 25,914 results for: cas9
-
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2T-gRNA2
Plasmid#196253PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA for guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-SpCas9-HF1
Plasmid#108293PurposepX459 V2.0 (Plasmid #62988) with the N497A, R661A, Q695A, and Q926A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceMay 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-CR102
Plasmid#234043Purposeexpresses ABE8e(V106W) - SpG Cas9 base editor in a human T cell optimized lentiviral transfer plasmidDepositorInsertTadA8e(V106W)-SpG-Cas9(D10A)-P2A-blast
UseLentiviralAvailable sinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
BCJJ339
Plasmid#117501PurposeRPS5a:Cas9:E9 Golden Gate Level 1 Position 2DepositorInsertBpiI:GCAA:RPS5a:Cas9-3(intron):E9:ACTA:BpiI
UseCRISPRExpressionPlantPromoterAtRPS5aAvailable sinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW90.dCas9-YY1
Plasmid#104373PurposeExpresses dCas9-YY1DepositorInsertdCas9-YY1
Available sinceJan. 8, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSET-dCas9
Plasmid#110183PurposeExpression of the dCas9 gene in StreptomycesDepositorInsertdCas9
UseCRISPR; IExpressionBacterialMutationD10A, H840APromoterermE*pAvailable sinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
dCas9-FOG1[N+C]
Plasmid#100085PurposedCas9 fused to two FOG1 peptide [aa 1-45] , one at the N-terminus and one at the C-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertFOG1(aa 1-45) (ZFPM1 Human)
UseCRISPRTags3XFLag-NLS-FOG1-dCas9-FOG1-NLSExpressionMammalianPromoterCMVAvailable sinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMA-SpCas9-g1
Plasmid#80784PurposeBsaI-based cloning of SpCas9 gRNA guide sequence, position 1/11/21 in the arrayDepositorInsertCRISPR gRNA expression cassette (for SpCas9)
UseCRISPRTagsnaExpressionMammalianPromoterU6Available sinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-sgRNA-RFP
Plasmid#166005PurposeBacterial expression of dCas9 (aTc control) and sgRNA (arabinose control)DepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable sinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX303-ABI1-dCas9
Plasmid#154474PurposeExpresses ABI1 fused to the N terminus of dCas9DepositorInsertABI1 (ABI1 Mustard Weed)
UseLentiviralExpressionMammalianMutationIncludes ABI1 aa 126-423, D143APromoterCMVAvailable sinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-SpCas9-HF1
Plasmid#108301PurposepX330 (Plasmid #42230) with the N497A, R661A, Q695A, and Q926A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pINDUCER dCas9-TET1CDMut
Plasmid#101920PurposeThe dCas9-TET1CDMut fusion protein is cloned into the pINDUCER lentiviral backbone (Addgene plasmid# 46948). The TET1 catalytic domain is mutated to abolish catalytic function.DepositorInsertdCas9-TET1CD Mut
UseLentiviralExpressionMammalianMutationMutated TET1 catalytic domainAvailable sinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC19-J6LE60
Plasmid#103117PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertJ6LE60(Cas9 coding gene from Rhodovulum sp. PH10)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E7MR72
Plasmid#103105PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE7MR72(Cas9 coding gene from Solobacterium moorei F0204)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-G2ZYP2
Plasmid#103110PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertG2ZYP2(Cas9 coding gene from Ralstonia syzygii R24)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
SID4x-dCas9-KRAB
Plasmid#106399PurposeExpresses catalytically inactive dCas9 with N-terminal fusion of Sin3a Interacting Domain (SID) and C-terminal fusion of repressive KRAB domainDepositorAvailable sinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAN-PTet-dCas9
Plasmid#62244Purposecontrols the expression of S. pyogenes dCas9 from a Tc‐inducible PTet promoter.DepositorInsertdCas9
UseCRISPRExpressionBacterialMutationcatalytically inactive, D10A, H840APromoterPtetAvailable sinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX459V2.0-SpCas9-HF1
Plasmid#108293PurposepX459 V2.0 (Plasmid #62988) with the N497A, R661A, Q695A, and Q926A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceMay 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by