We narrowed to 33,047 results for: cmv
-
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-CMV-GFP-Puro_TAL1-long
Plasmid#210642PurposeOverexpression of TAL1-longDepositorAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC130: pAAV.CMV-CasRx-VEGFA sgRNA
Plasmid#203443PurposePlasmid expressing active RfxCas13d with VEGFA mRNA targeting gRNADepositorInsertsU6-VEGFA sgRNA
RfxCas13d
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM149: pAAV.CMV-Cas13e-VEGFA sgRNA
Plasmid#203447PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNADepositorInsertsU6-VEGFA sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM155: pAAV.CMV-Cas13e (GenScript CO)-NT sgRNA
Plasmid#203451PurposePlasmid expressing active and codon optimised Cas13e with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianMutationCodon optimised using GenScript toolPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC368: pAAV.CMV-Cas13e-VEGFA sgRNA2
Plasmid#227800PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA2DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC369: pAAV.CMV-Cas13e-VEGFA sgRNA3
Plasmid#227801PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA3DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p39.pA.NGFR.mCMV.hPGK.SrtA(Pasqual).WPRE[sequenced]
Plasmid#226758Purposesecreted SrtA in p36DepositorInsertsortase A (srtA )
ExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
p32.pA.NGFR-mSrtA(Ge)-flag.mCMV.hPGK.GFP.wpre[sequenced]
Plasmid#226729Purposesortase A(GE) in p30DepositorInsertflag
ExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
p35.pA.NGFR.mCMV.hPGK.mSrtA(Pasqual)TM.WPRE[sequenced]
Plasmid#226760Purposesortase A (Pasqual)- TM in p36DepositorInsertsortase A (srtA )
ExpressionMammalianAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-human cGASdeltaN-OMM
Plasmid#186887PurposeExpression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal MAVS transmembrane domain fusion (Adamts1 Human, Synthetic)
UseLentiviralMutationN-terminal truncation, MAVS transmembrane domain …PromoterCMVAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-orangutan cGASdeltaN-OMM
Plasmid#186888PurposeExpression of orangutan cGAS gene in mammalian cells by retroviral transductionDepositorInsertOrangutan cGAS truncation mutant (158-521 a.a.) with C-terminal MAVS transmembrane domain fusion (CGAS Synthetic, Pongo abelii)
UseLentiviralMutationN-terminal truncation, MAVS transmembrane domain …PromoterCMVAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-SV40NLS-OgeuIscBE193A-3XHA
Plasmid#222861PurposeThis plasmid codes for the OgeuIscB nickaseDepositorInsertOgeuIscB Nickase
UseCRISPRTags3X HA and Nucleoplasmin NLS and ITR2ExpressionMammalianMutationE193A for nickase mutationPromoterCMVAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV:: NES-FKBP-iLID-LRP6c(△1-64)
Plasmid#221775PurposeExpresses NES-FKBP-iLID-LRP6c(△1-64) component in mammalian cellsDepositorInsertpCMV:: NES-FKBP-iLID-LRP6c
ExpressionMammalianPromoterCMV promoterAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Loxp-CMV-Loxp-GFP-LA
Plasmid#206199PurposeExpresses GFP-lamin-A only in non-myocyte when delivered into mice carrying a cardiomyocyte-specific Myh6-Cre transgeneDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-DNAJC5-ΔC30 (Δ169-198)
Plasmid#205722PurposeMammalian expression of DNAJC5-ΔC30 (Δ169-198)DepositorAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plx208-CMV-SspB-EGFP-VP16
Plasmid#213532PurposeExpresses one of the split transcription factor component in mammalian cellsDepositorInsertSspB-EGFP-VP16
UseLentiviralTagsEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mScarlet-I-eDHFR-ORP5(ΔPH)
Plasmid#214277PurposeMammalian expression of ORP5(ΔPH) fused to mScarlet-I-tagged E. coli DHFRDepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only