We narrowed to 4,684 results for: ARA-2
-
Plasmid#112015PurposeDNA sequence source for amplifying an HDR template to tag endogenous human BATF gene with GFPDepositorInsertBATF-GFP HDRT (BATF Human)
UseCRISPR and Synthetic BiologyAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synP-FLEX-splitTVA-EGFP-B19G (AAV1)
Viral Prep#52473-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-synP-FLEX-splitTVA-EGFP-B19G (#52473). In addition to the viral particles, you will also receive purified pAAV-synP-FLEX-splitTVA-EGFP-B19G plasmid DNA. Helper virus for monosynaptic tracing with rabies virus. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry (AAV2)
Viral Prep#35512-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry (#35512). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry plasmid DNA. CaMKIIa-driven, humanized channelrhodopsin E123T/T159C mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP (AAV5)
Viral Prep#35509-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP (#35509). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin E123T/T159C mutant fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP (AAV9)
Viral Prep#35509-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP (#35509). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin E123T/T159C mutant fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Cdc42/N12-Cdc42/13C(Q61L)-FKBP-mVenus-CAAX
Plasmid#214278PurposeExpress split-Cdc42 fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationCdc42-Q61LPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Cdc42/N12-Cdc42/13C(T17N)-FKBP-mVenus-CAAX
Plasmid#214279PurposeExpress split-Cdc42 fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationCdc42-T17NPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Rac1/N12-Rac1/13C(Q61L)-FKBP-mVenus-CAAX
Plasmid#214280PurposeExpress split-Rac1 fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationRac1-Q61LPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Rac1/N12-Rac1/13C(T17N)-FKBP-mVenus-CAAX
Plasmid#214281PurposeExpress split-Rac1 fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (N terminal on insert 1) and mVenus (on…ExpressionMammalianMutationRac1-T17NPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-RhoA/N12-RhoA/13C(T19N)-FKBP-mVenus-CAAX
Plasmid#214283PurposeExpress split-RhoA fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (N terminal on insert 1) and mVenus (on…ExpressionMammalianMutationRhoA-T19NPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP (AAV PHP.V1)
Viral Prep#104052-AAVPHP.V1PurposeReady-to-use AAV PHP.V1 particles produced from pAAV-CAG-DIO-EYFP (#104052). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-EYFP plasmid DNA. CAG-driven, Cre-dependent expression of EYFP. These AAV were produced with the PHP.V1 serotype, which permits efficient transduction of brain vascular cells. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFP (Cre-dependent)Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_NUP98_NSD1
Plasmid#205873PurposeExpress mEGFP-tagged fusion protein, NUP98_NSD1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Antibody#218110-rAbPurposeAnti-Rhodopsin chimeric recombinant antibody with fused mouse variable and rabbit constant domains; binds to TETSQVAPA sequence.DepositorRecommended ApplicationsWestern BlotReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMay 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pEGFP-N1 hMOG-alpha2-EGFP
Plasmid#160976PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform alpha2 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha2 (MOG Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV9)
Viral Prep#113050-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1m (AAV9)
Viral Prep#113049-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_DA1m (#113049). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1m plasmid DNA. Synapsin-driven expression of GRAB-DA1m dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_ACh3.0 (AAV9)
Viral Prep#121922-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_ACh3.0 (#121922). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_ACh3.0 plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent acethycholine(ACh) sensor GRAB-ACh3.0. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV Retrograde)
Viral Prep#113050-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-beta2-EGFP
Plasmid#160979PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform beta2 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant beta2 (MOG Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only