We narrowed to 4,991 results for: ARA-2
-
Plasmid#227172PurposeFor organ-specific expression of separated mCherry and UltraID in the pharyngeal muscle of C. elegans.DepositorInsertmCherry::P2A::UltraID
ExpressionWormPromotermyo-2Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_OT1.0 (AAV9)
Viral Prep#185386-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_OT1.0 (#185386). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_OT1.0 plasmid DNA. hSyn-driven expression of the genetically-encoded fluorescent oxytocin(OT) sensor GRAB_OT1.0 in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_OT1.0 (AAV1)
Viral Prep#185386-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-GRAB_OT1.0 (#185386). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_OT1.0 plasmid DNA. hSyn-driven expression of the genetically-encoded fluorescent oxytocin(OT) sensor GRAB_OT1.0 in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_OTmut (AAV1)
Viral Prep#185388-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-GRAB_OTmut (#185388). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_OTmut plasmid DNA. hSyn-driven expression of the genetically-encoded fluorescent oxytocin(OT) control sensor GRAB_OTmut in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_OTmut (AAV9)
Viral Prep#185388-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_OTmut (#185388). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_OTmut plasmid DNA. hSyn-driven expression of the genetically-encoded fluorescent oxytocin(OT) control sensor GRAB_OTmut in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPtGE35
Plasmid#107999PurposeExpresses TevCas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
I-TevI nuclease and partial linker domain
UseCRISPR and Synthetic Biology; Episomal vector for…TagsCas9Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST Halo-flag-CAD
Plasmid#188117PurposeExpresses N-terminal Halo-tagged/C-terminal flag-tagged human CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tag and Halo tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST EGFP-flag-CAD
Plasmid#188118PurposeExpresses N-terminal EGFP-tagged/C-terminal flag-tagged human CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsEGFP tag and Flag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD E1368A
Plasmid#188141PurposeExpresses C-terminal flag-tagged human CAD E1368A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD S1396A
Plasmid#188126PurposeExpresses C-terminal flag-tagged human CAD S1396A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD R2187A
Plasmid#169827PurposeExpresses C-terminal flag-tagged CAD with mutation at reported trimerization interface of the ATCase domain of CADDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationR2187A, T456A S1406A S1859A; TCCC -> AGTC sile…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD H1734A H1741A
Plasmid#169830PurposeExpresses C-terminal flag-tagged CAD with mutations at reported dimerization interface of the DHOase domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationH1734A H1741A; TCCC -> AGTC silent mutations a…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop1
Plasmid#169831PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids F1366 - P1376 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids F1366 - P1376; TCCC ->…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop2
Plasmid#169832PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids R1398 - S1407 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids R1398 - S1407; TCCC ->…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD L1405A
Plasmid#188136PurposeExpresses C-terminal flag-tagged human CAD L1405A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD A1400E
Plasmid#188137PurposeExpresses C-terminal flag-tagged human CAD A1400E in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD C1374S
Plasmid#188139PurposeExpresses C-terminal flag-tagged human CAD C1374S in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD E1367A
Plasmid#188140PurposeExpresses C-terminal flag-tagged human CAD E1367A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only