We narrowed to 9,970 results for: trac
-
Plasmid#47578PurposeBacterial expression plasmid for GST-3xHA-tagged constitutively active MKK7a1DepositorInsertMKK7a1-EE (Map2k7 Mouse)
UseTags3xHA and GSTExpressionBacterialMutationResidues 73-420 of RefSeq sequence. Ser271 to Gl…PromoterAvailable sinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2NS-IRES-dOrai-IRES-mCherry
Plasmid#72896PurposeMammalian expression of dmBACCS2NS, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2NS-IRES-dOrai-IRES-mCherry
UseTagsIRES-mCherryExpressionMammalianMutationPromoterCMVAvailable sinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
MO70 - Orai1 EC-Flag
Plasmid#79590PurposeTransient expression and retroviral ExpressionDepositorInsertOrai1 (ORAI1 Human)
UseRetroviralTagsFLAG (inserted between TM3 and TM4 of the protein…ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTBL1401 pLenti-pEF1a(short)-mNeonGreen-P2A-Cas9
Plasmid#163644PurposeMakes a lentivirus that expresses mNeonGreen and Cas9.DepositorInsertmNeonGreen-P2A-Cas9
UseLentiviralTagsmNeonGreen-P2AExpressionMutationPromoterEFSAvailable sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-Fc-His
Plasmid#72147PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema3f (Sema3f Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del3)-AP-His
Plasmid#72010PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3b(L)-AP-His
Plasmid#72013PurposeExpresses the Sema3B protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3b (Sema3b Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-AP-His
Plasmid#72012PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
mVenus-NES-SspB-Tiam-DHPH-P2A-iLIDcaax
Plasmid#173865PurposeMammalian expression of mVenus-NES-SspB-Tiam-DHPH-P2A-iLIDcaax (opto-Rac1)DepositorInsertmVenus-NES-SspB-Tiam-DHPH-P2A-iLIDcaax
UseTagsC-terminal CAAX-box and mVenusExpressionMammalianMutationPromoterCMVAvailable sinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
Plasmid#107728PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorInsertMAPRE1 gRNA #3 (targets Exon 1) (MAPRE1 Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc p31Comet
Plasmid#59833PurposeAllows the integration of myc p31Comet in the genome and Tet-inducible expression.DepositorInsertp31 (MAD2L1BP Human)
UseTagsMycExpressionMammalianMutationPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable sinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.3 HA-TSPAN12^11-LEL
Plasmid#115785PurposeExpresses a chimera in mammalian cells: the large extracellular loop of TSPAN12 is replaced with TSPAN11 sequenceDepositorUseTagsHAExpressionMammalianMutationlarge extracellular loop of TSPAN12 replaced with…PromoterCMVAvailable sinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2VL-IRES-dOrai-IRES-GFP
Plasmid#72897PurposeMammalian expression of dmBACCS2VL, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and GFPDepositorInsertdmBACCS2VL-IRES-dOrai-IRES-GFP
UseTagsIRES-GFPExpressionMammalianMutationPromoterCMVAvailable sinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-llo-mc38tmg
Plasmid#174603Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes ADGPK, DPAGT and Reps1DepositorInsertextracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-TPD53
Plasmid#172457PurposeExpression of Tumor Protein D52 like 1 (TPD53/TPD52L1) with N-terminal mCherry-FKBP tagDepositorInsertTPD53 (TPD52L1 Human)
UseTagsmCherry-FKBPExpressionMammalianMutationPromoterCMVAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Myc-delta/gamma2SIL
Plasmid#119731PurposeGABAA receptor expression (chimeric rat delta subunit whose large intracellular loop has been replaced with the large intracellular loop of the rat gamma 2 short subunit) Myc-tag near N-terminusDepositorUseTagscMyc epitope EQKLISEEDL inserted between fourth a…ExpressionMammalianMutationPromoterAvailable sinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAV10.F6.loxP
Plasmid#63201PurposepCACS backbone (Amp), KlURA3, contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. LoxP flanked TU. Integration into chrVI: 97873-98803 (NotI or BciVI).DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterial and YeastMutationPromoterAvailable sinceOct. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del13)-Fc-His
Plasmid#72137PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 13), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only