We narrowed to 9,200 results for: App;
-
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-CTSB-G418
Plasmid#158465PurposeConstitutive lentiviral expression of human CTSB.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-CTSB-puro
Plasmid#158463PurposeConstitutive lentiviral expression of human CTSB.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-CTSB-blast
Plasmid#158464PurposeConstitutive lentiviral expression of human CTSB.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-CTSB
Plasmid#158443PurposeGateway Cloning compatible entry vector for the human CTSB gene.DepositorInsertCTSB (CTSB Human)
UseGateway entry vectorAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-Sac-Abeta(MC1-40)
Plasmid#127152PurposeExpresses N-terminal cysteine Abeta(1-40)DepositorAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Archon1-KGC-GFP-ER2 (AAV8)
Viral Prep#115892-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-Archon1-KGC-GFP-ER2 (#115892). In addition to the viral particles, you will also receive purified pAAV-Syn-Archon1-KGC-GFP-ER2 plasmid DNA. Syn-driven Archon1, an opsin-based fluorescent voltage indicator, fused to EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFPAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] (AAV8)
Viral Prep#115893-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] (#115893). In addition to the viral particles, you will also receive purified pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] plasmid DNA. Syn-driven, Cre dependent Archon1, an opsin-based fluorescent voltage indicator, fused to EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFP (Cre-dependent)Available SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 (AAV5)
Viral Prep#108422-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 (#108422). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 plasmid DNA. CAG-driven, Cre dependent Archon1, an opsin-based fluorescent voltage indicator, fused to EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSelAct-KO
Plasmid#174374PurposePlasmid for unmarked deletions, pUC19 backbone, Apr resistant casette, codA::app counterselection casette, gateway compatibleDepositorTypeEmpty backboneUseVector for 2-step knockout by homologous recombin…PromoterN/AAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
paavCAG-post-mGRASP-2A-dTomato (AAV5)
Viral Prep#34912-AAV5PurposeReady-to-use AAV5 particles produced from paavCAG-post-mGRASP-2A-dTomato (#34912). In addition to the viral particles, you will also receive purified paavCAG-post-mGRASP-2A-dTomato plasmid DNA. CAG-driven expression of post-synaptic mGRASP-2A-dTomato for synaptic connectivity mapping. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsdTomatoAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
paavCAG-pre-mGRASP-mCerulean (AAV5)
Viral Prep#34910-AAV5PurposeReady-to-use AAV5 particles produced from paavCAG-pre-mGRASP-mCerulean (#34910). In addition to the viral particles, you will also receive purified paavCAG-pre-mGRASP-mCerulean plasmid DNA. CAG-driven expression of presynaptic mGRASP-mCerulean for synaptic connectivity mapping. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCeruleanAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-mSA2
Plasmid#52319PurposeSolubly expresses monomeric streptavidin containing S25H mutation in E. coli as an MBP fusion. App Microbiol & Biotech 98, 6285-6295 (2014)DepositorInsertmonomeric streptavidin 2
TagsFLAG, His, MBP, and TEVExpressionBacterialMutationS25H mutation compared to streptavidinPromoterT7Available SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET-Trx-mSA2
Plasmid#52320PurposeSolubly expresses monomeric streptavidin containing S25H mutation in E. coli as a thioredoxin fusion. App Microbiol & Biotech 98, 6285-6295 (2014)DepositorInsertmonomeric streptavidin 2
TagsFLAG, His, S tag, TEV site, and ThioredoxinExpressionBacterialMutationS25H mutation compared to streptavidinPromoterT7Available SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDESTmycPABPC4
Plasmid#19877DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO eNpHR 3.0-EYFP (AAV5)
Viral Prep#26966-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-DIO eNpHR 3.0-EYFP (#26966). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO eNpHR 3.0-EYFP plasmid DNA. EF1a-driven, cre-dependent eNpHR 3.0-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO eNpHR 3.0-EYFP (AAV9)
Viral Prep#26966-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Ef1a-DIO eNpHR 3.0-EYFP (#26966). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO eNpHR 3.0-EYFP plasmid DNA. EF1a-driven, cre-dependent eNpHR 3.0-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V1 (Concentrated Lentiviral Prep)
Viral Prep#115643-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V1 (#115643). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V1 plasmid DNA. <p><p>Ready-to-use lentiviral particles carrying version 1 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.</p></p>DepositorPromoterMinimal CMVTagsEGFPAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO eNpHR 3.0-EYFP (AAV1)
Viral Prep#26966-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Ef1a-DIO eNpHR 3.0-EYFP (#26966). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO eNpHR 3.0-EYFP plasmid DNA. EF1a-driven, cre-dependent eNpHR 3.0-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only