We narrowed to 10,558 results for: ESP
-
Plasmid#196616PurposePlasmid for integrating tetO7-controlled sfGFP into the HO region in yeastDepositorInsertSuperfolder GFP
ExpressionYeastPromotertetO7 promoterAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRS6E1b-luc(-732/-721) WT
Plasmid#45383DepositorInsert6 copies of hPAI-1 promoter -732/-721
UseLuciferaseTagsluciferaseExpressionMammalianAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MBP-2xNLS-tdTomato
Plasmid#104054PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein tdTomato from the MBP promoterDepositorInsert2xNLS-tdTomato
UseAAVTagsNLSPromoterMBPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-A
Plasmid#177811PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWay21-MKP-1 FL
Plasmid#13469DepositorAvailable SinceJan. 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPB-EF1A-Puro-hTBK1-EGFP
Plasmid#221553PurposeExpresses GFP-tagged human TBK1 in mammalian cells. Compatible with piggybac transposase for genome integration.DepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-A
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4552 x6NFATRE (NFAT) Ben DsRed-Express2 in TUPV1
Plasmid#244201PurposeExpression of a DsRed-Express2 reporter under an NFAT-responsive promoterDepositorInsertNFAT-responsive promoter (6 NFAT binding sites + YB_TATA), dsRed-Express2 reporter
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-NLRC5
Plasmid#37521DepositorAvailable SinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-CD19 puro
Plasmid#196634PurposeExpress CD19DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP
Plasmid#104055PurposeAn AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV2, and AAV5InsertEYFP
UseAAVPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA C/EBP gamma
Plasmid#15715DepositorAvailable SinceSept. 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HDAC6.DC-FLAG
Plasmid#30483DepositorInsertHDAC6 (HDAC6 Human)
TagsFLAGExpressionMammalianMutationCatalytically inactive mutant (H216/611A)Available SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
HypoxCR
Plasmid#59946PurposeA lentiviral dual fluorescent protein reporter, HypoxCR, detects hypoxic [hypoxia-inducible factor (HIF) active] and/or cycling cells.DepositorInsertsGFP-Pest
mCherry-Geminin
UseLentiviralTagsFLAG and PESTExpressionMammalianPromoterCMV and min CMVAvailable SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-LKB1
Plasmid#8590DepositorAvailable SinceJuly 18, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 p53 WT
Plasmid#69003Purposemammalian expression of wild type human p53DepositorAvailable SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT (PGK) 12xHRE-NanoLuc
Plasmid#208575Purposehypoxic response element driven NanoLuc Lentiviral reporterDepositorInsertsNanoLuciferase
d2eGFP
12xHRE
UseLentiviral, Luciferase, and Synthetic BiologyTags3x SV40 NLS and PESTExpressionMammalianAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only