We narrowed to 7,014 results for: tac
-
Plasmid#193602PurposePGD knockoutDepositorInsertsgPGD guide 1 (PGD Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_ST-sgRNA
Plasmid#188705PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human safe targeting lociDepositorInsertST sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Blimp1-L2-#2
Plasmid#171506Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_control_NGFR
Plasmid#189800PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.scr_1
Plasmid#190703PurposeExpresses scrambled sgRNA and Cas9-Puro in Drosophila S2 cellsDepositorInsertScrambled sgRNA 1
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.scr_3
Plasmid#190705PurposeExpresses scrambled sgRNA and Cas9-Puro in Drosophila S2 cellsDepositorInsertScrambled sgRNA 3
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DPB
Plasmid#164989PurposeExpression of gRNA targeting HLA-DPB locus, including DPB1*01:01:01DepositorInsertgRNA against HLA-DPB1*01:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DHFR
Plasmid#183281PurposeAll-in-One CRISPRko system with a guide RNA that targets DHFR geneDepositorInsertDHFR
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TYMS
Plasmid#183326PurposeAll-in-One CRISPRko system with a guide RNA that targets TYMS geneDepositorInsertTYMS
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ROS1
Plasmid#183320PurposeAll-in-One CRISPRko system with a guide RNA that targets ROS1 geneDepositorInsertROS1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_SMO
Plasmid#183321PurposeAll-in-One CRISPRko system with a guide RNA that targets SMO geneDepositorInsertSMO
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MAP2K1
Plasmid#183308PurposeAll-in-One CRISPRko system with a guide RNA that targets MAP2K1 geneDepositorInsertMAP2K1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC1
Plasmid#183297PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC1 geneDepositorInsertHDAC1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CDK6
Plasmid#183276PurposeAll-in-One CRISPRko system with a guide RNA that targets CDK6 geneDepositorInsertCDK6
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CDK4
Plasmid#183275PurposeAll-in-One CRISPRko system with a guide RNA that targets CDK4 geneDepositorInsertCDK4
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AR
Plasmid#183271PurposeAll-in-One CRISPRko system with a guide RNA that targets AR geneDepositorInsertAR
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Kcnn2-smFP-myc KI
Plasmid#183438PurposeFlpON knock-in for SK2-smFP-myc (amino acid position: T571)DepositorInsertgRNA and smFP myc donor
UseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
1046E=dgRNAs[traB,bTub]
Plasmid#149425PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes.DepositorInsertU6.3-gRNAs[TraB, bTub]
UseCRISPRExpressionInsectPromoterU6.3Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPKK0CM0480
Plasmid#177037PurposeLevel 0 promoter binding site part for MoClo assembly, nonstandard overlaps, CCAT-TACTDepositorInsert2x opattB binding site plus minimal CaMV 35S promoter plus partial TMV 'UTR
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only