We narrowed to 6,927 results for: Proc
-
Plasmid#29079DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-CreAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1114
Plasmid#29043DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSAvailable SinceDec. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1488
Plasmid#29239DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1294
Plasmid#29145DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEB2-mScarlet
Plasmid#104006PurposePlasmid encoding mScarletDepositorInsertmScarlet
UseLow copyExpressionBacterialMutationMutations relative to DsRed (MSKGE AVIKEF… N6A, R…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mRuby3
Plasmid#104004PurposePlasmid encoding mRuby3DepositorInsertmRuby3
UseLow copyExpressionBacterialMutationMutations relative to eqFP611 (MSKGEE LIKENMRMKVV…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mCherry2-L
Plasmid#104003PurposePlasmid encoding mCherry2-LDepositorInsertmCherry2-L
UseLow copyExpressionBacterialMutationMutations relative to DsRed (MSKGEE NNLA IIKEF… V…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mRuby3 Addgene
Plasmid#104005PurposePlasmid encoding mRuby3 AddgeneDepositorInsertmRuby3 Addgene
UseLow copyExpressionBacterialMutationMutations relative to eqFP611 (MSKGEE LIKENMRMKVV…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7b-WPRE (AAV1)
Viral Prep#104489-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP7b-WPRE (#104489). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7b-WPRE plasmid DNA. Syn-driven jGCaMP7b calcium sensor. jGCaMP7b exhibits the brightest resting fluorescence of the jGCaMP7 variants, and can be used for imaging of small neuronal processes. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (AAV1)
Viral Prep#104493-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (#104493). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7b-WPRE plasmid DNA. Synapsin-driven, Cre-dependent jGCaMP7b expression. jGCaMP7b exhibits the brightest resting fluorescence and can be used for imaging of small neuronal processes (dendrites and axons). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7b-WPRE (AAV Retrograde)
Viral Prep#104489-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-jGCaMP7b-WPRE (#104489). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7b-WPRE plasmid DNA. Syn-driven jGCaMP7b calcium sensor. jGCaMP7b exhibits the brightest resting fluorescence of the jGCaMP7 variants and can be used for imaging of small neuronal processes. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
HL 716
Bacterial Strain#60368PurposeLim Lab StrainDepositorBacterial ResistanceNoneAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mScarlet-I
Plasmid#104007PurposePlasmid encoding mScarlet-IDepositorInsertmScarlet-I
UseLow copyExpressionBacterialMutationMutations relative to DsRed (MSKGE AVIKEF… N6A, R…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS1602
Plasmid#29305PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748) and de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle131 (MKI67 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 4, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1600
Plasmid#29274PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).Pleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNDepositorInsertPle129 (MKI67 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 4, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1127
Plasmid#29049PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1225
Plasmid#29113PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1228
Plasmid#29114PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only