We narrowed to 6,132 results for: cat.2
-
Plasmid#114388PurposepDONR vector with SUMO1 geneDepositorInsertSUMO1 (SUMO1 Human)
UseTagsExpressionMammalianMutationQ29H compared with NCBI reference NP_003343.1PromoterAvailable sinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
DVA_p15A_AH
Plasmid#217602PurposeDestination vector with ampicillin resistance and p15A origin of replication. Carries A-H CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationNonePromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
DVA_pBR322_AH
Plasmid#217606PurposeDestination vector with ampicillin resistance and pBR322 origin of replication. Carries A-H CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationNonePromoterAvailable sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_p15A_AF
Plasmid#217604PurposeDestination vector with ampicillin resistance and p15A origin of replication. Carries A-F CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationNonePromoterAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_p15A_AG
Plasmid#217603PurposeDestination vector with ampicillin resistance and p15A origin of replication. Carries A-G CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationNonePromoterAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_p15A_EH
Plasmid#217605PurposeDestination vector with ampicillin resistance and p15A origin of replication. Carries E-H CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationNonePromoterAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_pBR322_AG
Plasmid#217607PurposeDestination vector with ampicillin resistance and pBR322 origin of replication. Carries A-G CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationNonePromoterAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_pBR322_AF
Plasmid#217608PurposeDestination vector with ampicillin resistance and pBR322 origin of replication. Carries A-F CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationNonePromoterAvailable sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVA_pBR322_EH
Plasmid#217609PurposeDestination vector with ampicillin resistance and pBR322 origin of replication. Carries E-H CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationNonePromoterAvailable sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSICO-CPSF6-358-eGFP
Plasmid#110693PurposeExpresses a truncated form of CPSF6 (CPSF6-358 originally described in Lee et al. Cell Host Microbe 2010) fused with eGFPDepositorInsertCPSF6-eGFP (CPSF6 )
UseLentiviralTagsEGFPExpressionMutationTruncation of CPSF6 isoform 2 at amino acid 358PromoterAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SHMT2 CD
Plasmid#106302PurposeExpresses SHMT2 K280A catalytic site mutantDepositorInsertserine hydroxymethyltransferase 2 (SHMT2 Human)
UseRetroviralTagsExpressionMammalianMutationK280A catalytic site mutation, Silent mutations d…PromoterAvailable sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFOXF2.1.0-gDNA
Plasmid#113784PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor FOXF2DepositorInsertFOXF2 (FOXF2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP GFP-MOSPD2 WT
Plasmid#186467PurposeExpression of human MOSPD2 fused to EGFP in mammalian cellsDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Human SHIP2
Plasmid#124645PurposeExpresses HIS tagged human SHIP2 in COS-7/HEK cellsDepositorInsertINPPL1 (INPPL1 Human)
UseTagsHis Xpress (N-terminal)ExpressionMammalianMutationcoding sequence starts at amino acid 18 as calcul…PromoterAvailable sinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:mTREK-1(K271Q)
Plasmid#133270PurposeX. laevis expression vector. It will generate the mouse TREK-1 channelDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 )
UseOocyte expressionTagsExpressionMutationK271QPromoterAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRA1SEGFPTcIfm
Plasmid#193777PurposeCassette 1: Expresses EGFP under the control of PR promoter, Cassette 2: Expresses frame-shifted CI under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertEGFP and frame-shifted CI in opposite orientation, controlled by separate promoters and terminators
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPR promoter and PLTetO-1Available sinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Puro DEST JNKKTR AA Clover
Plasmid#90238PurposeLentiviral vector to express JNK KTR AA (mutant) mClover under PGK promoter (With Puromycin Resistance)DepositorInsertJNK Kinase Translocation Reporter (AA mutant)
UseLentiviralTagsmCloverExpressionMammalianMutationPromoterPGKAvailable sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Puro DEST JNKKTR EE Clover
Plasmid#90239PurposeLentiviral vector to express JNK KTR EE (mutant) mClover under PGK promoter (With Puromycin Resistance)DepositorInsertJNK Kinase Translocation Reporter (EE mutant)
UseLentiviralTagsmCloverExpressionMammalianMutationPromoterPGKAvailable sinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only