We narrowed to 4,882 results for: EXO
-
Plasmid#130681PurposeExpresses human SMCHD1 Exon1-36 with a C-terminal 3xFLAG tagDepositorInsertSMCHD1 Exon1-36 (SMCHD1 Human)
UseTags3xFLAGExpressionMammalianMutationD1523_V2005delinsXPromoterCMVAvailable sinceSept. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp73-Exon4-3sgRNA
Plasmid#88850PurposeCRISPR KO of Trp73DepositorInsertTrp73 (Trp73 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp73-Exon4-4sgRNA
Plasmid#88851PurposeCRISPR KO of Trp73DepositorInsertTrp73 (Trp73 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-HIPK3 Exon
Plasmid#69888PurposeExpresses the human HIPK3 exon 2 circular RNA in DrosophilaDepositorInsertHIPK3 (HIPK3 Human, Fly)
UseTagsExpressionInsectMutationExpresses aa1-194 of HIPK3PromoterMetallothionein Promoter (pMT)Available sinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-E-cadherin(Canis)-exon1 6-28 gRNA
Plasmid#209922PurposeA knock-out vector for the dog CDH1DepositorInsertA gRNA targeting the dog CDH1 gene.
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1b) [N212A/34R-2b]
Plasmid#225413PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1b) (Mouse) IgG2b R-mAb. Derived from hybridoma N212A/34.DepositorInsertAnti-TRIP8b (exon 1b) (Mus musculus) recombinant (Mouse) monoclonal antibody. (Pex5l Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1a-5) [N291A/43R]
Plasmid#225389PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1a-5) (Mouse) IgG2a R-mAb. Derived from hybridoma N291A/43.DepositorInsertAnti-TRIP8b (exon 1a-5) (Mus musculus) recombinant (Mouse) monoclonal antibody. (Pex5l Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-MFF (exon 1) [N382/69R]
Plasmid#206565PurposeMammalian Expression Plasmid of anti-MFF (exon 1) (Human). Derived from hybridoma N382/69.DepositorInsertanti-MFF (exon 1) (Homo sapiens) recombinant Mouse monoclonal antibody (MFF Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-Exo-Blast-BFP
Plasmid#196721PurposeSortable and selectable SpCas9 fused to exodeoxyribonuclease I (sbcB) from E. coli. For the creation of longer deletions.DepositorInsertCas9-Exo1-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSExpressionMutationPromoterEF1aAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1b) [N212A/34R]
Plasmid#182108PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1b) (Mouse). Derived from hybridoma N212A/34.DepositorInsertanti-TRIP8b (exon 1b) (Mus musculus) recombinant mouse monoclonal antibody (Pex5l Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRPL28exon1-(Nhe/Mfe) SpHIS5 (pNTI619)
Plasmid#115432PurposeVector for expressing RPL28 with mutagenized exon2DepositorInsertsUseTagsExpressionYeastMutationexon 2 deleted, with MfeI / NheI cloning sitePromoterAshbya gospii TEF1 and endogenousAvailable sinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1a/5) [N291C/22R]
Plasmid#114563PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1a/5) (Mouse). Derived from hybridoma N291C/22.DepositorInsertanti-TRIP8b (exon 1a/5) (Mus musculus) recombinant mouse monoclonal antibody (Pex5l Mouse)
UseTagsExpressionMammalianMutationPromoterdual CMVAvailable sinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 40a
Plasmid#87894Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 40a (DYSF Human)
UseTagsExpressionBacterialMutationalternative isoforms, see commentsPromoterAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 5a, 17, 40a
Plasmid#87895Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 5a, 17, 40a (DYSF Human)
UseTagsExpressionBacterialMutationalternative isoforms, see commentsPromoterAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1a, 40a
Plasmid#87901Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1a, 40a (DYSF Human)
UseTagsExpressionBacterialMutationalternative isoforms, see commentsPromoterAvailable sinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only