We narrowed to 6,021 results for: crispr cas9 expression plasmids
-
Plasmid#71667PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-PuroR for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR (DNMT3A Synthetic, S. pyogenes, Human)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_v2
Plasmid#74407PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-PuroR (v2) for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR_v2 (DNMT3A Synthetic, S. pyogenes, Human)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable sinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Cre-ERT2 (EDCICE)
Plasmid#90086PurposeThis plasmid contains destabilized Cas9 and has Cre-ERT2 after IRES sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianMutationPromoterEFSAvailable sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX334-U6-DR-BB-DR-Cbh-NLS-hSpCas9n(D10A)-NLS-H1-shorttracr-PGK-puro
Plasmid#42333PurposeThis plasmid separately encodes a human codon-optimized SpCas9 nickase, a tracrRNA and customizable crRNA.DepositorArticleInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTagsHAExpressionMammalianMutationD10A nickase-converting mutationPromoterAvailable sinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-dSaCas9-KRAB-bGHpA
Plasmid#106219PurposeAAV expressing deactivated S. aureus Cas9 fused to a KRAB repressorDepositorInsertdead S. aureus Cas9 KRAB
UseAAV and CRISPRTagsHA-NLSExpressionMammalianMutationD10A and N580APromoterCMVAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMB1-A-ptet-FLAG-dCas9
Plasmid#190130PurposeLevel 1 MoClo plasmid containing an aTC inducible FLAG tagged dCas9 for CRISPRiDepositorInsertdCas9
UseCRISPRTagsFLAGExpressionMutationPromoterAvailable sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHCas9-Nours
Plasmid#107733PurposeEscherichia coli- S. cerevisiae shuttle plasmid harbors a Cas9 gene, a natMX6 and URA3 selection markers used in S. cerevisiaeDepositorInsertCas9
UseCRISPRTagsSV40 NLSExpressionYeastMutationHuman optimizedPromoterTEF1Available sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMVc-Cas9
Plasmid#106431PurposeExpresses SpCas9 from the CMVc promoter in AAV backboneDepositorInsertCas9
UseAAV and CRISPRTagsHA-NLS and NLSExpressionMammalianMutationPromoterCMVcAvailable sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-nEF-dCas9
Plasmid#106430PurposeExpresses SpdCas9 from the nEF promoter in AAV backboneDepositorInsertnEF-dCas9
UseAAV and CRISPRTagsHA-NLS and NLSExpressionMammalianMutationPromoternEFAvailable sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-Cas9
Plasmid#135010PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9DepositorInserthumanized S. pyogenes Cas9
UseTags3xFLAG (N terminal on insert)ExpressionMammalianMutationPromoterCBhAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE EF1α dCas9-NED
Plasmid#109369PurposeLentiviral vector for expressing effector domains fused to dCas9.DepositorTypeEmpty backboneUseCRISPR and LentiviralTags3xHAExpressionMammalianMutationPromoterEF-1αAvailable sinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationH840A and D10A mutations on spCas9 to inactivate …PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_mouse_Adar1_ccB
Plasmid#158122Purposedeletion mAdar1DepositorInsertAdar1 (Adar Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_mouse_Adar1_ccA
Plasmid#158120Purposedeletion mAdar1DepositorInsertAdar1 (Adar Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_mouse_Adar1_ccC
Plasmid#158121Purposedeletion mAdar1DepositorInsertAdar1 (Adar Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pScI_dCas9-CDA_J23119-sgRNA
Plasmid#108550PurposeBacterial Target-AID vector with sgRNADepositorInsertsdCas9-PmCDA1
Streptococcus pyogenes sgRNA
UseTagsFlagExpressionBacterialMutationD10A and H840A for SpCas9PromoterJ23119 and lambda ORAvailable sinceSept. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
HeFSpCas9
Plasmid#92355PurposeExpression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
HeFm1SpCas9
Plasmid#92110PurposeExpression plasmid for human codon-optimized increased fidelity HeFm1SpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity mut1 Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationR661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable sinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only