We narrowed to 25,370 results for: CHI;
-
Plasmid#242124PurposeExpression in mammalian cellsDepositorAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pRK5R DD-FAM98B
Plasmid#211357PurposeTransient expression of DD-V5-FAM98BDepositorAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(3)-pmRevErbA-Venus-NLS-Pest
Plasmid#240114PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter fragment.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-EnhancerAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(4)-pmRevErbA-Venus-NLS-Pest
Plasmid#240115PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-Enhancer+OriAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(2)-pmRevErbA-Venus-NLS-Pest
Plasmid#240113PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-Enhancer+OriAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(3)-pmRevErbA-mScaI3-NLS-Pest
Plasmid#240117PurposeA lentiviral (red) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter fragment.DepositorInsertmurine Nr1d1 promoter+mScarlet-I3-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-EnhancerAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-Rac1(dog)
Plasmid#228760PurposeA knockdown vector for dog Rac1.DepositorInsertA shRNA targeting the dog Rac1 gene (RAC1 canis lupus)
ExpressionMammalianAvailable SinceJuly 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-N+C-term K-R
Plasmid#233093PurposeExpression of GST-YihI with N+C-term lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with N+C-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with N+C-term lysines (K) mutated to arg…Available SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term K-R
Plasmid#233091PurposeExpression of GST-YihI with N-term lysines (K) mutated to arginine (R)DepositorInsertYihI with N-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationN-terminal lysine residues mutated to arginineAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-S1BD
Plasmid#232580PurposeExpression of the Rnr S1 and basic domains (residues 1930 to 2442) as a GST-fusion.DepositorInsertRnr S1 + basic domain (residues 1930 to 2442)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-CSD
Plasmid#232578PurposeExpression of the Rnr cold shock domains I and II (residues 1 to 648) as a GST-fusion.DepositorInsertRnr cold shock domains I and II (residues 1 to 648)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-All K-R
Plasmid#233094PurposeExpression of GST-YihI with all lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with all lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with all lysines (K) mutated to arginine…Available SinceMay 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS-Twin-strep-TEV-DGKδ2-DSAMD
Plasmid#223721PurposeExpress human diacylglycerol kinase delta 2- SAM domain deletion mutant (N-terminal TEV protease cleavable Twin-Strep-fusion protein) in mammalian cellDepositorInsertDGKD (DGKD Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted sterile alpha motif domain (deleted amino…PromoterCAG and chicken β-actin promoterAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL01V6
Plasmid#218249Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL01V6 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL01V9
Plasmid#218250Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL01V9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL08V9
Plasmid#218251Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL08V9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL01
Plasmid#218248Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL01 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only