We narrowed to 10,638 results for: ESP
-
Plasmid#18073DepositorAvailable SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only
-
pGEX-2TK-CR-CT
Plasmid#18074DepositorAvailable SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-CR-d-ZZ
Plasmid#18075DepositorAvailable SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-EF1
Plasmid#18081DepositorAvailable SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-36aa
Plasmid#18082DepositorAvailable SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (D210N)
Plasmid#196703PurposePlasmid for transient mammalian expression of catalytically inactive RNase H1 mutant.DepositorInserthuman RNaseH1 D210N
ExpressionMammalianMutationD210N, catalytically inactiveAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
VEGFR2-mCh
Plasmid#108854PurposeEncodes for human VEGFR2 fluorescently labeled with mCherry on the C-Terminus via a 3 amino acid (GGS) flexible linkerDepositorAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc hSeparase
Plasmid#59820PurposeAllows the integration of myc hSeparase in the genome and Tet-inducible expression.DepositorInsertSeparase (ESPL1 Human)
TagsMycExpressionMammalianPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_puro_CAG_HexaPro
Plasmid#164077PurposeTargeted integration of SARS-CoV-2 spike HexaPro variant into the AAVS1 genomic safe harbor locusDepositorArticleInsertSARS-CoV-2 S HexaPro (S Severe acute respiratory syndrome coronavirus 2)
UseCRISPRTags2X Strep-Tag II, 8X His tag, and HRV 3C cleavage …ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCAGAvailable SinceJan. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-RNaseHI-NES-EGFP
Plasmid#196701PurposePlasmid for stable expression of wild type bacterial RNase HI tagged with NES and EGFP that can be used to specifically degrade the DNA-RNA hybrids in the cytoplasm.DepositorInsertbacterial RNaseHI
UseLentiviralAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti HRE-Luc pGK Hygro
Plasmid#118706Purposereporter plasmid HIF-responsive promoter (3xHRE) wt- fused to firefly luciferaseDepositorInsertHRE (HIF-responsive promoter (3xHRE)-luc
UseLentiviralAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDblet
Plasmid#8848DepositorInsertARS doublet
UseYeast cloning vectorExpressionYeastMutationThis vector contains, between AatII sites, a dire…Available SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSCALPs-HA-NFAT1 (4-460)-GFP
Plasmid#88879PurposeLentiviral vector expressing the fusion protein HA-NFAT1 (4-460)-GFPDepositorInsertHA-NFAT1 (4-460)-GFP fusion protein (Nfatc2 Mouse)
UseLentiviralTagsGFP fusion protein and HA tagExpressionMammalianMutationamino acids 4-460 only; L78P & L287P *see bel…PromoterSFFV (spleen focus forming virus)Available SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT/Caggs-NRASV12
Plasmid#20205DepositorAvailable SinceFeb. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBA439
Plasmid#85967PurposePerturb-seq vector backboneDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-LUC2CP/ARE
Plasmid#62857PurposeSplicing reporter control (no intron) with elements to shorten the half-life of the luciferase protein as well as the luciferase mRNA.DepositorInsertLuciferase
UseLuciferaseExpressionMammalianMutationdestabilizing sequences (DS) added to the C termi…PromoterCMVAvailable SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1365 LV EF1a-CD28 IRES-EGFP
Plasmid#201921Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD28DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Nrf1-Myc pcDNA3.1(+)-C-Myc
Plasmid#169125Purposeexpression of proteinDepositorAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only