We narrowed to 87,317 results for: ina
-
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Halo XRCC4
Plasmid#207541PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous XRCC4 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human XRCC4 locus sequences
TagsHaloTagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-terminal Halo-Ku70
Plasmid#207547PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous Ku70 locus.DepositorInsertHaloTag with flanked by human Ku70 locus sequences
TagsHaloTagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactiveEmpty
Plasmid#213168PurposeEmpty Vector (no sgRNA) used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mCardinal
Plasmid#197258PurposeExpresses the protein mCardinal in bacteriaDepositorInsertmCardinal
ExpressionBacterialAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Mss4-Kina
Plasmid#202739Purposeexpresses fluorescent protein-tagged enzymeDepositorInsertmCherry:S. cerevisiae Mss4 (377-756) (MSS4 Human)
ExpressionMammalianAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TagBFP2-Mss4D636K-Kina
Plasmid#202725Purposeexpresses fluorescent protein-tagged enzymeDepositorInsertmTagBFP2:S. cerevisiae Mss4(377-756)(D636K) (MSS4 Budding Yeast)
ExpressionMammalianAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
TagBFP2-Mss4-Kina
Plasmid#202724Purposeexpresses fluorescent protein-tagged enzymeDepositorInsertmTagBFP2:S. cerevisiae Mss4(377-756) (MSS4 Budding Yeast)
ExpressionMammalianAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Mss4D636K-Kina
Plasmid#202740Purposeexpresses fluorescent protein-tagged enzymeDepositorInsertmCherry:S. cerevisiae Mss4 (377-756)(D636K) (MSS4 Human)
ExpressionMammalianAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1_mNeongreen-StefinA
Plasmid#182418PurposeBacterial expression of mNeongreen-stefinA fusionDepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T-Easy-NematocilinA
Plasmid#193010PurposePlasmid to generate an ISH probe for Hydra Nematocilin ADepositorInsertHydra Nematocilin A
UseCloning vectorAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only