We narrowed to 14,194 results for: EGFP
-
Plasmid#91718PurposeAAV-mediated expression of mEGFP and paAIP2 for optogenetic control of CaMKIIDepositorInsertmEGFP-P2A-paAIP2
UseAAVPromoterCaMKII 1.3Available SinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-β-catenin_S23A,T40A,T41A,T112A
Plasmid#190824PurposeFor mammalian expression of β-catenin with 4 O-GlcNAc sites mutated (S23A, T40A, T41A and T112A) and GFP-tag on its N-terminus.DepositorInsertβ-catenin (CTNNB1 Chicken)
TagsGFPExpressionMammalianMutationS23A, T40A, T41A, T112APromoterCMVAvailable SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVQ CMV NanoV1-2a-EGFP ferritin
Plasmid#79649PurposeExpresses camelid anti-GFP nanobody fused to TRPV1 and GFP-ferritin chimera fusion proteinDepositorInsertsUseAdenoviralExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-TRE>{MCS}:T2A:EGFP
Plasmid#236250PurposeHygromycin selected lentiviral vector with MCS for tetracycline-inducible gene, for use with dual-inducible CymR-CuO systemDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterTREAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMVTRE3G eGFP Puro (w819-1)
Plasmid#27570DepositorInsertEnhance Green Fluorescent Protein
UseLentiviralExpressionMammalianAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-ConVERGD-eGFP-W3SL
Plasmid#218748PurposeProvides AND intersectional (Cre+Flp) expression of eGFPDepositorInserteGFP
UseAAVPromoterCAGAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMuLE_EXPR_CMV-eGFP_TOP-iRFP_PTCH1-mTurquoise2_CBF-tdTomato
Plasmid#113865PurposeTriple pathway reporter, 3P-Fluor; wnt-iRFP, hedgehog-mTurquoise2, notch-tdTomato; plus CMV-eGFP. Gateway expression vector for lentivirus generation.DepositorInsertsCMV-eGFP
TOP-iRFP
PTCH1-mTurquoise2
CBF-tdTomato
UseLentiviralExpressionMammalianAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-eGFP-WPRE
Plasmid#203843PurposeFlp-dependent EGFP expressionDepositorInsertEGFP
UseAAVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG BacMam C term 3C eGFP StrepII
Plasmid#160686PurposeVector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target proteinDepositorTypeEmpty backboneTags3C eGFP StrepIIExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-EF1A-Puro-hTBK1-EGFP
Plasmid#221553PurposeExpresses GFP-tagged human TBK1 in mammalian cells. Compatible with piggybac transposase for genome integration.DepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-EGFP-PARP1
Plasmid#176146PurposeEGFP fused to the N-terminus of PARP1 & a hygromycin resistance cassetteDepositorInsertPoly(ADP-Ribose) Polymerase 1 (PARP1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-gfap(Intron1/5'/Exon1-zebrafish)
Plasmid#39761DepositorAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-WT-P2A-EGFP (BKS953)
Plasmid#242651PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpCas9-P2A-EGFP
UseCRISPRExpressionMammalianMutationABE8.8 mutations in TadAPromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Archon1-KGC-EGFP
Plasmid#108418PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-KGC-EGFP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-EGFP-ALDH1A3-Neo
Plasmid#189744PurposeThe construct was used to express GFP tagged human ALDH1A3 in mammalian cells for the analysis of the subcellular location of this protein.DepositorAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
5'UTR CGG 99x FMR1-EGFP
Plasmid#63091PurposeContains expanded CGG repeats (99 repeats) within the 5'UTR of FMR1 as found in the Fragile X Tremor Ataxia Syndrome (FXTAS). These repeats are in frame with EGFP.DepositorInsertexpanded CGG repeats (99 repeats) within the 5'UTR of FMR1 (FMR1 Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEG BacMam N term StrepII eGFP 3C
Plasmid#160683PurposeVector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target proteinDepositorTypeEmpty backboneTagsStrepII eGFP 3CExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-Patchless
Plasmid#194553PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "Patchless" variantDepositorInsertHMGB1 (HMGB1 Human)
TagsmEGFPExpressionMammalianMutationK184Rfs*44, truncation by stop codon after Lys209Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1A-Gephyrin.FingR-eGFP-CCR5TC
Plasmid#125692PurposeGlobal labeling of inhibitory synapses (green fluorescence)DepositorInsertGephyrin.FingR-eGFP-CCR5TC
UseAAVExpressionMammalianPromoterEF1AAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only