We narrowed to 5,689 results for: dre
-
Plasmid#203854PurposeTet-inducible lentiviral plasmid expressing NR3C1-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertNR3C1 (NR3C1 Human)
ExpressionMammalianAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEAHISMRSA0482
Plasmid#96968Purposeexpression of methicillin-resistant Staphylococcus aureus orf 0482DepositorInsertMRSA ORF0482
TagsN-ter TEV protease cleavable 6HisExpressionBacterialMutationnonePromoterT7Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBabe-kappa-HA-dL5-myc-ADRB2
Plasmid#101253PurposeExpresses HA-dL5(E52D)-cMyc N-terminal fusion of beta-2 adrenergic receptor in mammalian cells, MMLV retroviral plasmid (MBIC5, dL5**, FAP, ADRB2)DepositorInsertkappa-HA-dL5-myc-ADRB2 (ADRB2 Budding Yeast, Human)
UseRetroviralTagsFAP-dL5 and HA epitopeExpressionMammalianPromoterMMLV LTRAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEAHISMRSA2028
Plasmid#97001PurposeExpressing MRSA Asp/Tyr/Phe pyridoxal-50- phosphate-dependent aminotransferaseDepositorInsertAsp/Tyr/Phe pyridoxal-50- phosphate-dependent aminotransferase
TagsN-ter TEV protease cleavable 6HisMutationnonePromoterT7Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_UPF3A/UPF3B (pAVA3129)
Plasmid#239329PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting UPF3A and UPF3BDepositorInsertU6-driven sgRNA1 targting UPF3A and 7SK-driven sgRNA2 targeting UPF3B (UPF3B Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
YjdC-R82A_pET-14b
Plasmid#233276PurposeOverexpress his-tag YjdC protein with a site directed mutagenesis, arginine at position 82 was substituted with alanine (R82A)DepositorInsertYjdC (yjdC )
ExpressionBacterialMutationArginine was replaced with Alanine at position 82…PromoterT7 promoterAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
YjdC-R64A_pET-14b
Plasmid#233263PurposeOverexpress his-tag YjdC protein with a site directed mutagenesis, arginine at position 64 was substituted with alanine (R64A)DepositorInsertYjdC (yjdC )
ExpressionBacterialMutationArginine was replaced with Alanine at position 64…PromoterT7 promoterAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
HemH-R212A_pET-14b
Plasmid#233262PurposeOverexpress his-tag HemH protein with a site directed mutagenesis, arginine at position 212 was substituted with alanine (R121A)DepositorInsertHemH (hemH )
ExpressionBacterialMutationArginine was replaced with Alanine at position 21…PromoterT7 promoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_StrepII-Hook2_FTS_FHIP2A
Plasmid#222302PurposeCo-expresses full-length human FHF (FTS, StrepII-HOOK2 and FHIP2A) in a pBIG1a vectorDepositorTagsStrepII-PscExpressionInsectAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
shTRIP13-2-seed
Plasmid#184535PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
shTRIP13-1
Plasmid#184536PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
shTRIP13-2
Plasmid#184537PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
KChIP3 K+ channel scFv [K66/27]
Plasmid#206760PurposeMammalian Expression of KChIP3 K+ channel scFV. Derived from hybridoma K66/27 scFv.DepositorInsertKChIP3 K+ channel (Rattus norvegicus) recombinant scFV (Kcnip3 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
KChIP3 K+ channel scFv [K66/38]
Plasmid#206761PurposeMammalian Expression of KChIP3 K+ channel scFV. Derived from hybridoma K66/38 scFv.DepositorInsertKChIP3 K+ channel (Rattus norvegicus) recombinant scFV (Kcnip3 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
KChIP3 K+ channel scFv [K66/59]
Plasmid#206762PurposeMammalian Expression of KChIP3 K+ channel scFV. Derived from hybridoma K66/59 scFv.DepositorInsertKChIP3 K+ channel (Rattus norvegicus) recombinant scFV (Kcnip3 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-CSRNP2-P2A-mCherry
Plasmid#203867PurposeTet-inducible lentiviral plasmid expressing CSRNP2-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertCSRNP2 (CSRNP2 Human)
ExpressionMammalianAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only