We narrowed to 10,466 results for: UTY
-
Plasmid#243672PurposeExpresses MBP-tagged FUS RGG3 domain in bacteriaDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only
-
6xHis-FUS-LCdel
Plasmid#243671PurposeExpresses 6xHis-tagged FUS with LC domain deletion in bacteriaDepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2784 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-20a CMV-BFP
Plasmid#240514PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-20 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2785 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-125a CMV-BFP
Plasmid#240515PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-125a Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2786 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-151a CMV-BFP
Plasmid#240516PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-151a Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2787 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-221 CMV-BFP
Plasmid#240517PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-221 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW27K_7Ti1
Plasmid#177294Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and LacZDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW07K_0G5
Plasmid#177279Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmRDepositorInsertPaacC1-aacC1
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW08K_0C5
Plasmid#177280Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with CmRDepositorInsertPcat-cat
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW11K_0S5
Plasmid#177282Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with SmRDepositorInsertPaadA-aadA
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW20K_0Ti1
Plasmid#177289Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcRDepositorInsertPtet-tetA(C)
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomaKGECO1
Plasmid#232839PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted KGECO1DepositorInsertNES-SomaKGECO1
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterSynAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-DIO-ExRai-AKAR2-T/A
Plasmid#171847PurposeCre-dependent, synapsin promoter-driven expression of the negative control phosphomutant ExRai-AKAR2 T/A PKA biosensor in neurons.DepositorInsertExRai-AKAR2 T/A
UseAAVExpressionMammalianMutationT6A phospho-deficient mutationPromoterhSyn1Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-ASD2HFD-GFP
Plasmid#237430PurposeExpresses Mus musculus CENP-T with ancestral HFD (mouse:rat); tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with ancestral HFD (Cenpt Mouse)
TagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from mouse:rat anc…PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-RpHFD-GFP
Plasmid#237428PurposeExpresses Mus musculus CENP-T with Rhabdomys pumilio HFD; tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with Rhabdomys pumilio HFD (Cenpt Mouse)
TagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from Rhabdomys pum…PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-McHFD-GFP
Plasmid#237437PurposeExpresses Mus musculus CENP-T with Mus caroli HFD; tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with Mus caroli HFD (Cenpt Mouse)
TagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from Mus caroliPromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-RnHFD-GFP
Plasmid#237429PurposeExpresses Mus musculus CENP-T with Rattus norvegicus HFD; tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with Rattus norvegicus HFD (Cenpt Mouse)
TagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from Rattus norveg…PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-MsHFD-GFP
Plasmid#237427PurposeExpresses Mus musculus CENP-T with Mus spretus HFD; tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with Mus spretus HFD (Cenpt Mouse)
TagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from Mus spretusPromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-30a-NSP14-SARS-CoV
Plasmid#236424Purposebacterial protein expression of NSP14DepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only