We narrowed to 8,766 results for: lic
-
Plasmid#127866PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1APC20 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryMutationC-terminal 20 amino acids onlyPromoterhSynAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-M-Flag-BAP1-F170C
Plasmid#125848Purposeexpress mutant BAP1-F170CDepositorAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-M-Flag-BAP1-G109V
Plasmid#125846Purposeexpress mutant BAP1-G109VDepositorAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
p3x-Flag Gli3 30R3-1
Plasmid#120304PurposeExpresses human protein Gli containing a 4HT-inducible intein evolved to operate at 30CDepositorInsert30R3-1, Gli3
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_SNORD27h_115mut
Plasmid#73068Purposeexpression clone for human mutated SNORD27 (C/D box snoRNA U27)DepositorInsertSNORD27 (SNORD27 Human)
Tagsno tagExpressionMammalianMutationexpression cassette for SNORD27 with AS box from …Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-hPMCA2xb
Plasmid#47751Purposemammalian expression of mCherry tagged hPMCA2, xb splice variantDepositorInsertPMCA2x/b (ATP2B2 Human)
TagsmCherryExpressionMammalianMutationxb splice variantPromoterCMVAvailable SinceNov. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_altPKA-Cα-mPAGFP
Plasmid#114133PurposeAlternative spliced variant of the mouse PKA catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertTestis only splice variant of mouse PKA catalytic subunit α that has no myristoylation site, C-terminally tagged by mPAGFP (Prkaca Mouse)
ExpressionMammalianAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS303 prp8-101
Plasmid#111307Purposeprp8-101DepositorAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-A8REH9
Plasmid#103084PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertA8REH9(Cas9 coding gene from Eubacterium dolichum DSM 3991)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-J9E534
Plasmid#103078PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertJ9E534(Cas9 coding gene from Alicyclobacillus hesperidum URH17-3-68)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBS1202 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 4xΦ]
Plasmid#107845PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll hydrophobics combined in four clusters in spl…Available SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBS1203 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 2xΦ]
Plasmid#107844PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll hydrophobics combined in two clusters in spli…Available SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGS_N_3xFLAG
Plasmid#101654PurposeExpression of type I signal-peptide containing proteins with N-terminal 3xFLAG-tag in insect cellsDepositorInsertLRP6 Signal peptide, KpnI linker, 3xFLAG tag
Tags3xFLAG tagExpressionInsectAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-human-BNIP3 delta Exon2
Plasmid#100782PurposeMammalian expression of BNIP3 delta Exon2 splice variantDepositorInserthuman-BNIP3 delta Exon2 (BNIP3 Human)
TagsHAExpressionMammalianMutationExon2 deletionPromoterCMVAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-PRMT9 G260E mutant
Plasmid#67610Purposebacterial expression of GST-PRMT9 G260E Double E loop mutantDepositorInsertPRMT9 (PRMT9 Human)
TagsGSTExpressionBacterialMutationG260E double E loop mutantPromotertacAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-PRMT9 D258G mutant
Plasmid#67609Purposebacterial expression of GST-PRMT9 D258G Double E loop mutantDepositorInsertPRMT9 (PRMT9 Human)
TagsGSTExpressionBacterialMutationD258G double E loop mutantPromotertacAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (P27A)
Plasmid#62068PurposeExpression of human p53 (1-73) (P27A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; P27APromoterT7Available SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-H4-23
Plasmid#55491PurposeLocalization: Nucleus/Histones, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-PRKRA
Plasmid#31571DepositorInsertprotein kinase, interferon-inducible double stranded RNA dependent activator (PRKRA Human)
TagsHis and TEVExpressionBacterialAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only