We narrowed to 14,450 results for: cas9 genes
-
Plasmid#99502Purpose3XFlag::meGFP with 2 introns::Ollas::H2B::tbb-2 3utr::linker::TEVDepositorInsert3XFlag::meGFP with 2 introns::Ollas::H2B::tbb-2 3’utr::linker::TEV
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEM-2t
Plasmid#159752PurposeCRISPR/Cas9 genome editing in plants; a template for PCR-derived fragments used in the assembly of polycistronic transcripts, where sgRNAs are separated by an Arabidopsis alanine tRNA.DepositorArticleInsertsgRNA
UseCRISPRAvailable SinceOct. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSc1-DD
Plasmid#80439PurposeExpresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsE. coli dihydrofolate reductaseExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSc1-puro
Plasmid#80438PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cell, and also confers resistance to puromycinDepositorInsertssp Cas9 gRNA
eGFP
Puromycin resistance
UseCRISPRExpressionMammalianPromoterCMV, U6, and hPGKAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ENL)
Plasmid#69212PurposeLentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; MLL-ENL,(t[11;19])DepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Puro-HEK3 CTT ins
Plasmid#171996PurposeDelivers all prime editing (nickase) components targeting the HEK3 site for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA HEK3 +90
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro HEK3 CTT ins
Plasmid#171995PurposeDelivers all prime editing nuclease components targeting the HEK3 gene for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorInsertHEK3 CTT insertion pegRNA and CbH-Cas9-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA sham
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceSept. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D/S293D
Plasmid#115202PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D/S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D/S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS1099: Dual-sgRNA.Design 4
Plasmid#159537PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 with two guide RNA cassettes
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRISPaint Gene Tagging Kit
Plasmid Kit#1000000086PurposeCRISPR-assisted insertion tagging (CRISPaint) plasmid collection for modular integration of large DNA fragments into user-defined genomic locations via a ligase-4-dependent mechanism.DepositorApplicationGenome EditingVector TypeMammalian ExpressionEditing TypeCRISPRAvailable SinceSept. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLoxP-DHFR-mCherry
Plasmid#70147PurposeExpresses a DHFR-mCherry fusion protein and uses for a CRISPR gene deletionDepositorInserta selectable dihydrofolate reductase-thymidylate synthase marker
UseExpression in toxoplasma gondiiTagsmCherryPromoterDHFR 5' UTRAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUREF-EX
Plasmid#199331PurposeA pEF-BOS-EX-derived expression vector that contains an SV40 promoter-driven puromycin resistance geneDepositorTypeEmpty backboneExpressionMammalianAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC_sgRNA
Plasmid#68710PurposeContains the sgRNA backbone sequence (tracrRNA, 82 bp) and is used as DNA template to amplify a specific sgRNA using a forward primer with the protospacer sequence for gene targeting.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceSept. 14, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits