We narrowed to 24,316 results for: crispr
-
Plasmid#77085Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PIP5K1B gRNA (BRDN0001148929)
Plasmid#77086Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME2 gRNA (BRDN0001487089)
Plasmid#77932Purpose3rd generation lentiviral gRNA plasmid targeting human NME2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001147559)
Plasmid#78005Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001487102)
Plasmid#78006Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SGK3 gRNA (BRDN0001146019)
Plasmid#75540Purpose3rd generation lentiviral gRNA plasmid targeting human SGK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SGK3 gRNA (BRDN0001146281)
Plasmid#75541Purpose3rd generation lentiviral gRNA plasmid targeting human SGK3DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
PNKP gRNA (BRDN0001147028)
Plasmid#77162Purpose3rd generation lentiviral gRNA plasmid targeting human PNKPDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-CS-154
Plasmid#166230Purposelenti-U6-gRNA::CMVp-nCas9-PmCDA1-UGI-2A-mCherryDepositorInsertsU6-gRNA EGFP targetting
nCas9-PmCDA1-UGI-2A-mCherry
UseCRISPR and LentiviralPromoterCMV promoter and Human U6Available SinceDec. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC101
Plasmid#62335PurposesgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AcrIIC1X
Plasmid#128112PurposeAcrX expression in mammalian cells; AcrX is an engineered anti-CRISPR protein targeting S. aureus Cas9DepositorInsertAcrX (AcrIIC1 N3F/D15Q/A48I)
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
PRKRA gRNA (BRDN0001146443)
Plasmid#76299Purpose3rd generation lentiviral gRNA plasmid targeting human PRKRADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAK4 gRNA (BRDN0001147629)
Plasmid#77573Purpose3rd generation lentiviral gRNA plasmid targeting human PAK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM27 gRNA (BRDN0001149189)
Plasmid#77514Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM27DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM27 gRNA (BRDN0001149307)
Plasmid#77515Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM27DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROCK2 gRNA (BRDN0001145177)
Plasmid#76351Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPN186
Plasmid#91573PurposeExpress sgRNA targeting human AKT3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA5 gRNA (BRDN0001145521)
Plasmid#77372Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only