We narrowed to 13,088 results for: plasmids 101
-
Plasmid#173965PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertHuman minimal enhancer region 1 (min1) and mouse minimal enhancer region 2 (min2) from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-EC1.45-human_min1-lizard_min2
Plasmid#173969PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertHuman minimal enhancer region 1 (min1) and lizard minimal enhancer region 2 (min2) from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 5 Spacer
Plasmid#172733PurposeEncodes Part 5 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 4 Spacer
Plasmid#172732PurposeEncodes Part 4 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 3 Spacer
Plasmid#172731PurposeEncodes Part 3 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1 Spacer
Plasmid#172729PurposeEncodes Part 1 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1b Spacer
Plasmid#172728PurposeEncodes Part 1b of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1a Spacer
Plasmid#172727PurposeEncodes Part 1a of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBIG1b_nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169162PurposeBaculoviral transfer vector to express SARS-CoV-2 nsp10 in insect cellsDepositorInsertnsp10-6His-3xFlag (ORF1ab SARS-CoV-2, Synthetic)
Tags6His-3xFlagExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_3xFlag-6His-nsp14 (SARS-CoV-2)
Plasmid#169163PurposeBaculoviral transfer vector to express SARS-CoV-2 nsp14 in insect cellsDepositorInsert3xFlag-6His-nsp14 (ORF1ab SARS-CoV-2, Synthetic)
Tags3xFlag-6HisExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-HA-mCherry-pA
Plasmid#233029PurposeTo Express HA Tagged hfCas13d-mCherry fusion protein from the mammalian EFS promoterDepositorInserthfCas13d-mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
PGK-HA-PGRN
Plasmid#234872PurposeLentiviral plasmid expressing HA-tagged human progranulin.DepositorAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-HA-mCherry-pA
Plasmid#233030PurposeTo Express HA tagged DjCas13d-mCherry fusion protein from the mammalian EFS promoterDepositorInsertDjCas13d-mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV U6-DR30(sapI)-0.5Syn-CasRX-mCherry-pA
Plasmid#192489PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoter0.5SynAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV U6-DR30(sapI)-0.4CaMKIIa-CasRX-mCherry-pA
Plasmid#192490PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoter0.4CaMKIIaAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-GFP-pA
Plasmid#192493PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-T2A-mCherry-pA
Plasmid#192497PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGgaatacattaccaacGTGGTGtacGTGPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only