We narrowed to 17,226 results for: REV
-
Plasmid#166232PurposeExpresses reversibly switchable A-kinase activity reporter with EV-linker inactive T/A mutant (rsAKARev(T/A)) in mammalian cellsDepositorInsertReversibly switchable A-kinase activity reporter with EV-linker inactive T/A mutant
ExpressionMammalianMutationchanged Threonine 506 in rsAKARev to AlaninePromoterCMVAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 2573
Plasmid#107233PurposeshRNA 2573. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 1122
Plasmid#107232PurposeshRNA 1122. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRevTre-mKLF5
Plasmid#41744DepositorInsertKlf5 (Klf5 Mouse)
ExpressionMammalianAvailable SinceJuly 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV9)
Viral Prep#87306-AAV9PurposeReady-to-use AAV9 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gal1/10 His6 TEV Ura S. cerevisiae expression vector (12URA-B)
Plasmid#48304DepositorTypeEmpty backboneUseNaTagsHis6Available SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rev(CMV-TagBFP2)-EFS-mCherry-133-MRE
Plasmid#235157PurposeExpresses the mCherry-based sensor for miR-133. TagBFP2 is expressed as a transduction reporterDepositorInsertmCherry with a miR-133 MRE from Ankrd28
UseAAVPromoterEFSAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rev(CMV-TagBFP2)-EFS-mCherry-124-WT-MRE
Plasmid#235147PurposeExpresses the mCherry-based sensor for miR-124. TagBFP2 is expressed as a transduction reporterDepositorInsertmCherry with a miR-124 MRE from Slc31a2
UseAAVPromoterEFSAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rev(CMV-TagBFP2)-EFS-mCherry-137-MRE
Plasmid#235160PurposeExpresses the mCherry-based sensor for miR-137. TagBFP2 is expressed as a transduction reporterDepositorInsertmCherry with a miR-137 MRE from Neurod4
UseAAVPromoterEFSAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synP-FLEX-splitTVA-EGFP-B19G (AAV1)
Viral Prep#52473-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-synP-FLEX-splitTVA-EGFP-B19G (#52473). In addition to the viral particles, you will also receive purified pAAV-synP-FLEX-splitTVA-EGFP-B19G plasmid DNA. Helper virus for monosynaptic tracing with rabies virus. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJMC-L1-Reverse-Donor-Esp3I
Plasmid#197845PurposeDonor vector to restore L1 destination via Esp3I (reverse orientation)DepositorInsertNone
UseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD/HisB (TIREVOL)-PAmCherry1
Plasmid#189718Purposetitratable expression of PAmCherry1 in bacteriaDepositorInsertPAmCherry1
TagsHis-T7-EKExpressionBacterialPromoterpBADAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD/HisB (TIREVOL)-mNG
Plasmid#189722Purposetitratable expression of mNeonGreen in bacteriaDepositorInsertmNeonGreen
TagsHis-T7-EKExpressionBacterialPromoterpBADAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/10R]
Plasmid#177528PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/10R.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant mouse monoclonal antibody (Bcan Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Reverse-Complement
Plasmid#136016PurposeThe Reverse Complement of EIF3B 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-JeT-pmRevErbA-mScaI3-NLS-Pest
Plasmid#240107PurposeA lentiviral (red) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by synthtic JeT promoter.DepositorInsertmurine Nr1d1 promoter+mScarlet-I3-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded JeT PromoterAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRevTRE MKL1-N100 S449A/T450A/S454A
Plasmid#19849DepositorInsertMKL1-N100 S449A/T450A/S454A (MRTFA Human)
UseRetroviralTags3xFLAGMutationdeleted amino acids 1-100 and changed Serine 449,…Available SinceFeb. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
Gal1/10 His6-MBP TEV Ura S. cerevisiae expression vector (12URA-C)
Plasmid#48305DepositorTypeEmpty backboneUseNaTagsHis6 and MBPAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
m6A-Tracer-NES
Plasmid#159607PurposeConstitutive transient mammalian expression of m6A-Tracer protein (Kind et al. 2013) with a C-terminal HIV-1 Rev Nuclear Export Signal to reduce background due to nonspecific DNA interactions.DepositorInsertm6A-Tracer-NES
ExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only