We narrowed to 166,131 results for: addgene
-
-
-
-
TAL3184
Plasmid#41358DepositorInsertZebrafishCommunity-stac-Left (LOC100005402 Zebrafish)
Uset7Tags3X Flag and WT FOKIExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
TAL3185
Plasmid#41359DepositorInsertZebrafishCommunity-stac-Right (LOC100005402 Zebrafish)
Uset7Tags3X Flag and WT FOKIExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPB-EF1α-IB-H2B-HaloTag
Plasmid#247449PurposeExpresses H2B fused with HaloTag.DepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT PCSK5(sgRR,M452I)-V5
Plasmid#232450PurposeGateway entry vector for an inducible sg09 resistant PCSK5_M452I mutantDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT PCSK5(sgRR,T288P)-V5
Plasmid#232451PurposeGateway entry vector for an inducible sg09 resistant PCSK5_T288P mutantDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLIK PCSK5(sgRR)-V5 hygro
Plasmid#232452PurposeLentiviral expression vector for an inducible sg09 resistant PCSK5DepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLIK PCSK5(sgRR,M452I)-V5 hygro
Plasmid#232453PurposeLentiviral expression vector for an inducible sg09 resistant PCSK5_M452I mutantDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLIK PCSK5(sgRR,T288P)-V5 hygro
Plasmid#232454PurposeLentiviral expression vector for an inducible sg09 resistant PCSK5_T288P mutantDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-DEN2
Plasmid#238020Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-TMV
Plasmid#238021Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-A3A-DEN2
Plasmid#238019Purposefor DNA-free cytosine base editing in rice and wheat or other plantsDepositorInsertA3A-nSpCas9(D10A)-UGI
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Torso
Plasmid#244933PurposeCRISPR gRNA targeting the C-terminal end of Torso for cleavage.DepositorInsertgRNA targeting Torso C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Btl
Plasmid#244934PurposeCRISPR gRNA targeting the C-terminal end of Breathless for cleavage.DepositorInsertgRNA targeting Btl C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-EGFR
Plasmid#244932PurposeCRISPR gRNA targeting the C-terminal end of EGFR for cleavage.DepositorInsertgRNA targeting EGFR C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
ABE8e SpG Puro
Plasmid#235044PurposeAdenosine base editor 8e* with SpG nicking Cas9 makes A > G editsDepositorInsertABE8e, nCas9
UseCRISPR and LentiviralTagsP2A-PuroRPromoterEF1a coreAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
WT-Cas9
Plasmid#239382PurposeFor circular RNA-mediated inverse prime editor using WTCas9 in HEK294T cellsDepositorInsertCas9
UseCRISPRTagsBPNLS and SV40 NLSExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only
