We narrowed to 9,991 results for: FIE
-
Plasmid#184106Purposecyclofen-inducible apoptosis activation and imaging (tEosFP) by zebrafish transient transgenesis or mRNA synthesisDepositorInsertmyr-DIAP1-5myc-tEosFP-nls'-P2A-Casp9-ERT2
UseZebrafish transient transgenesis + in vitro trans…Tagsinternal tag: 5mycMutationDIAP1: deleted 1-2, N19G, N20V, deleted 146-438; …PromoterZf-Ubi+SP6Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-10 in pcDNAI/Amp
Plasmid#55619PurposeAn amino-terminal CFP fragment was fused to Ggamma-10. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP-(1-158)-gamma-10 (GNG10 Human, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-10 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-5 in pcDNAI/Amp
Plasmid#55617PurposeAn amino-terminal CFP fragment was fused to Ggamma-5. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-5 (GNG5 Aequorea victoria, Bovine)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-5 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-7 in pcDNAI/Amp
Plasmid#55618PurposeAn amino-terminal CFP fragment was fused to Ggamma-7. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-7 (GNG7 Human, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-11 in pcDNAI/Amp
Plasmid#55620PurposeAn amino-terminal CFP fragment was fused to Ggamma-11. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-11 (GNG11 Aequorea victoria, Bovine)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-11 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-12 in pcDNAI/Amp
Plasmid#55621PurposeAn amino-terminal CFP fragment was fused to Ggamma-12. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-12 (GNG12 Human, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-12 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-1 in pcDNAI/Amp
Plasmid#55623PurposeAn amino-terminal mCerulean fragment was fused to Ggamma-1. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-1 (GNGT1 Aequorea victoria, Bovine)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-1 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55624PurposeAn amino-terminal mCerulean fragment was fused to Ggamma-2. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-2 (Gng2 Aequorea victoria, Mouse)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-2 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-7 in pcDNAI/Amp
Plasmid#55626PurposeAn amino-terminal mCerulean fragment was fused to Ggamma-7. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-7 (GNG7 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-10 in pcDNAI/Amp
Plasmid#55627PurposeAn N-terminal mCerulean fragment was fused to Ggamma-10. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-10 (GNG10 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-10 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-11 in pcDNAI/Amp
Plasmid#55628PurposeAn N-terminal mCerulean fragment was fused to Ggamma-11. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-11 (GNG11 Aequorea victoria, Bovine)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-11 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-12 in pcDNAI/Amp
Plasmid#55629PurposeAn N-terminal mCerulean fragment was fused to Ggamma-12. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-12 (GNG12 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-12 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-5 in pcDNAI/Amp
Plasmid#55191PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-5. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-5 (GNG5 Aequorea victoria, Bovine)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-5 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-11 in pcDNAI/Amp
Plasmid#55193PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-11. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-11 (GNG11 Aequorea victoria, Bovine)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-11 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196084Purpose(Empty Backbone) Inducible CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196078Purpose(Empty Backbone) Constitutive CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
HS_NAM-B1
Plasmid#154064PurposeLevel M, P1 Golden Gate vector. OsAct::Hyg-nosT/HvHSP17::Cre-hspT/ZmUbi::loxP-GUS-loxP-NAM-B1-nosTDepositorInsertsHygromycin phosphotransferase
Cre recombinase
LoxP-flanked GUS and TtNAM-B1
UseCre/Lox and Synthetic Biology; Golden gateExpressionBacterial and PlantMutationThe TtNAM-B1 gene sequence was domesticated to re…PromoterHvHSP17, OsAct, and ZmUbiAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-1 in pcDNAI/Amp
Plasmid#54468PurposeAn amino-terminal YFP fragment was fused to Gbeta-1. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP (1-158)/beta-1 (GNB1 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-1 was amplified via PCR, which removed an i…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196076Purpose(Empty Backbone) Constitutive CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196080Purpose(Empty Backbone) Inducible CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Blasticidin S deaminase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-2 in pcDNAI/Amp
Plasmid#54469PurposeAn amino-terminal YFP fragment was fused to Gbeta-2. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-2 (GNB2 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196074Purpose(Empty Backbone) Constitutive CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-5 in pcDNAI/Amp
Plasmid#54470PurposeAn amino-terminal YFP fragment was fused to Gbeta-5. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-5 (GNB5 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-1 in pcDNAI/Amp
Plasmid#55592PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-1. When co-expressed with an amino-trerminal CFP or YFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCFP (159-238)-Beta 1 (GNB1 Human, Aequorea victoria)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT646 human L1 ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro
Plasmid#213026PurposeExpresses full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLCAR-CD19-28z
Plasmid#135991PurposeModular CD28-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralExpressionMammalianPromoterEF1a-shortAvailable SinceJune 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLCAR-CD19-CD3z
Plasmid#135993PurposeModular CD3z alone CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralExpressionMammalianPromoterEF1a-shortAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLD564 human L1 ORF2p-3xFlag (L1RP, CMV promoter) in pCEP4 Puro
Plasmid#213030PurposeExpresses full length human LINE-1 in human cells (native L1RP sequence), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (L1RP Sequence) with 5' UTR and ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianPromoterCMVAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only