We narrowed to 6,373 results for: KIT
-
Plasmid#140539PurposeRAD21 tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
JWW-2 human chimeric monoclonal antibody
Plasmid#66749PurposeExpresses a murine/human chimeric IgG1 HPV16 L2-specific neutralizing antibody that recognizes HPV16 L2 amino acid region 58-64 . JWW-2 works in ELISA/WB/HPVDepositorInsertsJWW-2 Heavy Chain
JWW-2 Light Chain
ExpressionMammalianPromotermEF1 and rEF1Available SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJH127
Plasmid#162483PurposeSEC plasmid containing LG1 homology arms and myo-2p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH130
Plasmid#162484PurposeSEC plasmid containing LG1 homology arms and myo-3p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA
Plasmid#55201PurposePlasmid encoding the Ribozyme/gRNA architecture. This is a modified form of the original plasmid described in the paper (Construct 13). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
CTCF-C CRISPR
Plasmid#140647PurposeCTCF tagging CRISPRDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hEGF
Plasmid#199231PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorInsertEpidermal growth factor, partial (EGF Human)
TagsTrxA-6xHis-S-tagExpressionBacterialPromoterT7Available SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR P4-P1R-EGFP
Plasmid#48348PurposeContributes the coding sequence for EGFP as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway entry vectorMutationContains a Kozak sequence. Does not contain a sto…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-dTom
Plasmid#178718PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(46))-PGKpuro2ABFP-W
Plasmid#200465PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(46) (SMARCA2 Human)
UseLentiviralAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC-CTSS
Plasmid#172415PurposeMAC-tagged gene expressionDepositorAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
HAP40 1-371
Plasmid#124060PurposeBaculovirus expression vector for HAP40 protein (aa 1-371) in insect cellsDepositorInsertHAP40 (F8A1 Human)
UseBaculovirus expressionTags6x His and TEV cleavage sitePromoterpolyhedrinAvailable SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hHBEGF
Plasmid#199234PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorInsertProheparin-binding EGF-like growth factor (HBEGF Human)
TagsTrxA-6xHis-S-tagExpressionBacterialPromoterT7Available SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA
Plasmid#55202PurposePlasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
GABA(A) receptor subunit g2SE
Plasmid#49170PurposepHluorin-tagged GABA A receptor subunit (gamma 2) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit gamma 2 (Gabrg2 Mouse)
Tagsmyc, pHGFP (pHluorin), and thrombin cleavage site…ExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMXs-ms-Klf5
Plasmid#50787Purposeretroviral expression of mouse Klf5DepositorAvailable SinceFeb. 28, 2014AvailabilityAcademic Institutions and Nonprofits only