We narrowed to 6,060 results for: cat.2
-
Plasmid#240299PurposeKI:Lmnb1 Donor:3xV5 KO:NeuNDepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Gphn#1
Plasmid#240307PurposeDonor:smFP-V5 KO:Gphn#1DepositorInsertKO gRNAs for Gphn
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Sptbn4 Donor;3xV5 KO;Nfasc
Plasmid#240296PurposeKI:Sptbn4 Donor:3xV5 KO:NfascDepositorInsertKI gRNA for Sptbn4
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Actb Donor;3xV5 KO;Dlg4
Plasmid#240292PurposeKI:Actb Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Actb
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV 3xgRNA KO;Rbfox3
Plasmid#240311PurposeKO:NeuNDepositorInsertKO gRNAs for NeuN
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC86_HBA1(tEPOR-2A-YFP)
Plasmid#232405PurposeAAV production plasmid for tEPOR-2A-YFP vector from Fig. 2 that mediates HDR at HBA1 locus using HBA1-sg4 gRNA. HBA1 UTRs flank full tEPOR-2A-YFP cassette. Homology arms mediate full HBA1 replacement.DepositorUseAAVExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC131_CCR5(SFFV-synEPOR-2A-YFP)
Plasmid#232412PurposeAAV production plasmid for SFFV(synEPOR) vector from Figs. 2-3 that mediates HDR at CCR5 locus using CCR5 gRNA. YFP is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC89_CCR5(UbC-tEPOR-2A-YFP)
Plasmid#232404PurposeAAV production plasmid for UbC-tEPOR-2A-YFP vector from Fig. 2 that mediates HDR at CCR5 locus using CCR5-sg3 gRNA. YFP is followed by a BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2[∆TM]-Strep (SB260)
Plasmid#227609PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 lacking its transmembrane region in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastMutationcontains aa 2-544, 651-757 only [TM deleted]PromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2[∆TM,∆HB2]-Strep (SB261)
Plasmid#227610PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 lacking its transmembrane region and helical bundle 2 (HB2) in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastMutationcontains aa 2-400, 706-757 [TM and HB2 deleted]PromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC4 CD H976Y
Plasmid#224250PurposeExpresses human KDAC4 (HDAC4) catalytic domain H976Y in E. coliDepositorInsertKDAC4 (HDAC4 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationOnly includes residues 648-1083 (catalytic domain…PromoterT5Available SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJExpress401-KDAC8 H143A
Plasmid#224342PurposeExpresses human KDAC8 (HDAC8) H143A in E. coliDepositorInsertKDAC8 H143A (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationHistidine 143 mutated to alaninePromoterT5Available SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA-MYC-As-NF-kB3
Plasmid#180205PurposeExpresses MYC-tagged Acanthoeca spectabilis NF-kB3 protein in mammalian cellsDepositorInsertAs-NF-kB3
TagsMYC-tagged fusion proteinExpressionMammalianMutationaa 2-412PromoterCMVAvailable SinceSept. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FLAG-Co-RHD
Plasmid#180198PurposeExpresses FLAG-tagged version of the Co-NF-kB Rel Homology DomainDepositorInsertCo-RHD
TagsFLAG-tagged fusion proteinExpressionMammalianMutationaa 2-582PromoterCMVAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FLAG-As-NF-kB2
Plasmid#180201PurposeExpresses FLAG-tagged Acanthoeca spectabilis NF-kB2 protein in mammalian cellsDepositorInsertAs-NF-kB2
TagsFLAG-tagged fusion proteinExpressionMammalianMutationaa 2-502PromoterCMVAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CMV-SCLM
Plasmid#216758PurposeAAV2 transfer vector with the CMV promoter for ubiquitous expression of SuperClomeleonDepositorInsertSuperClomeleon followed by WPRE and human growth hormone polyA terminator
UseAAVExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCMV (cytomegalovirus)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
(R)pGPD1(D)_P1(SBE109)
Plasmid#194993Purposepromoter of the gene glyceraldehyde-3-phosphate dehydrogenase from R. toruloides for a P1 position (overhangs R/D)DepositorInsert(R) pGPD (D)
ExpressionBacterialAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only