We narrowed to 6,024 results for: crispr cas9 expression plasmids
-
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_PEmax-2A-BSD
Plasmid#234071PurposeFor lentiviral expression of PEmax with blasticidin resistanceDepositorInsertPEmax
UseCRISPR and LentiviralTagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterEF-1α core promoterAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSH-Csy4-T2A-SpRFN-P2A-GFP-multi-gRNA
Plasmid#85756PurposeAll in one plasmid that expresses Csy4, S.pyogenes FokI-dCas9-NLS, and GFP. Also encodes for multiplexed gRNAs. Backbone derived from pSQT1601 (Addgene #53369).DepositorInsertsCsy4-T2A-SpRFN-P2A-GFP
gRNA
UseCRISPRTagsCsy4, Csy4 recognition sequence, FokI fusion via …ExpressionMammalianMutationD10A, H840APromoterCMV and U6Available SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
LCV2_LacZ_sgRNA_2
Plasmid#155093Purposelentiviral plasmid expressing Cas9 and gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_Luciferase_sgRNA
Plasmid#155094Purposelentiviral plasmid expressing Cas9 and gRNA targeting LuciferaseDepositorInsertLuciferase_sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGH020_sgRNA_G418-GFP
Plasmid#85405Purposehu6 driven sgRNA vector with G418 and GFP selectable markersDepositorInsertG418 resistance and GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWZ194
Plasmid#163640Purposerps-27>DHB::2xmKate2-P2A-H2B::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::2mKate2-P2A-H2B::GFP::3xHA (his-58 Synthetic, Nematode)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAWK61
Plasmid#163642Purposerps-27>DHB::GFP-P2A-H2B::2xmKate2 expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::GFP-P2A-H2B::2xmKate2::3xHA (his-58 Human, Nematode)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only