We narrowed to 1,548 results for: SIR
-
Plasmid#75359PurposeNt His-tag Jatropha curcas Sacsin 1-1304DepositorInsertSacsin Jatropha-curcas 1-1304
TagsHis-TagExpressionBacterialAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100L-siResist
Plasmid#49854PurposeEncodes human connexin 43 with M100 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100 mutated to Leucine. Contains severa…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to bulged siRNA
Plasmid#40765PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to bulged target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed siRNA
Plasmid#40766PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant pLV-SigmaR1-mNeonGreen
Plasmid#226569PurposeEncodes siRNA resistant SigmaR1 protein labeled with mNeonGreen (lentiviral vector)DepositorAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPUR-hU6-sgRNA-Sirius-8XMS2
Plasmid#121942PurposeCRISPR-Sirius plasmidDepositorInsertsgRNA-Sirius-8XMS2
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterhuman U6 promoterAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-SRSF1 siRNA-resitant
Plasmid#218974PurposeVector for expressing siRNA-resistant SRSF1 cDNA (siRNA sequence: CGUGGAGUUUGUACGGAAA)DepositorInsertSRSF1 cDNA
ExpressionMammalianMutationsiRNA-resistant SRSF1 cDNA (siRNA sequence: CGUGG…PromoterCMVAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICE-FLAG-NAT10-siR-G641E
Plasmid#59366PurposePlasmid for constitutive or doxycycline-inducible expression of G641E mutant of human NAT10 resistant to a siRNA. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorInsertNAT10 NM_024662 (NAT10 Human)
TagsFLAGExpressionMammalianMutationG641E and silent mutations to render the cDNA res…PromoterCMV-tetAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPUR-mU6-sgRNA-Sirius-8XPP7
Plasmid#121943PurposeCRISPR-Sirius plasmidDepositorInsertsgRNA-Sirius-8XPP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromotermouse U6 promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only