We narrowed to 7,972 results for: lif
-
Plasmid#172695PurposePunc-25-gfp1-10 Expresses split GFP parts 1-10 specifically in C. elegans GABAergic motor neurons (only shows active fluorescence when binds to GFP11)DepositorInsertPunc-25
TagsGFP 1-10ExpressionWormAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ptrc::RpaA D53A
Plasmid#105229Purposeinducible expression of unphosphorylatable variant of RpaA (D53A)DepositorInsertrpaA driven by Ptrc promoter
UseCyanobacteria cloning vectorMutationD53 mutated to APromoterptrcAvailable SinceJan. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Char-BFP2-TSERex
Plasmid#124792PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertChar-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCO489
Plasmid#139732PurposeModule plasmid, individual component of Fungal Bioluminescent Pathway, LuzDepositorInsertpMOD_D_AtuMas:NnLuz:trbcSE9
UseLuciferaseExpressionPlantPromoterAtuMASAvailable SinceMay 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
HJP-224-actin5C^Syn21Gal80^IVS-Syn21myr-tdTomato-10UAS-mCD8GFP-p10w
Plasmid#162481PurposeA bicistronic construct - FloxGal80 and UAS-mCD8GFPDepositorInsertCre80Tom-GFP
UseCre/LoxAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMK33/intein-Cas9_S219-3XFLAG
Plasmid#133782PurposeExpresses human codon-optimized intein-Cas9DepositorInsertHuman codon-optimized intein-Cas9
ExpressionInsectAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-RPL13A-FKBPx4
Plasmid#104474PurposePlasmid for pop-in/pop-out replacement of RPL13A with an FKBPx4-tagged version.DepositorInsertRPL13Ap (RPL13A Budding Yeast)
TagsFKBPx4-HAExpressionYeastMutationincludes the last 354 bp of RPL13A onlyAvailable SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNP154
Plasmid#106360PurposeA vector backbone, including mKate, to be used to make constructs to be inserted as a single copy at a site on Chr II.DepositorTypeEmpty backboneExpressionWormAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
LexAop2->Bxb1.STOP>myr::4xSNAPf
Plasmid#87640PurposeFor creating drosophila transgenics expressing LexAop2->Bxb1.STOP>myr::4xSNAPfDepositorInsertmyr::4xSNAPf
ExpressionInsectAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFLIP30
Plasmid#65499PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-mCer-cMycExpressionBacterialPromoterT7 promoterAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFLIP32
Plasmid#65500PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-t7CFPt9-cMycExpressionBacterialPromoterT7 promoterAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFLIP39
Plasmid#65507PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-edAFPt9-attR1 and attR2-t7edCFPt9-cMycExpressionBacterialPromoterT7 promoterAvailable SinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDonr201_PARG WT
Plasmid#240315PurposeEntry vector for Gateway with PARGDepositorInsertPARG (PARG Human)
ExpressionBacterialAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJFT7_nHalo_DC(r4)_PARG_Mutation
Plasmid#240316PurposeGateway compatible vector expressing PARG (E755/756A)DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEE-moxBFP-IRES-PuroR
Plasmid#242413PurposeSpectral unmixing: moxBFP onlyDepositorInsertsmoxBFP
IRES-PuroR
UseSelf-amplifying rnaExpressionMammalianAvailable SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEE-mScarlet3-IRES-PuroR
Plasmid#242415PurposeSpectral unmixing: mScarlet3 onlyDepositorInsertsmScarlet3
IRES-PuroR
UseSelf-amplifying rnaExpressionMammalianAvailable SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BoxB-petracrRNA
Plasmid#207625PurposeExpresses BoxB-petracrRNA in mammalian cells (with a human-U6 promoter)DepositorInsertBoxB-petracrRNA
UseSynthetic BiologyPromoterhU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM198
Plasmid#227657PurposepRS305 His-HRV3C-Rpn5 WTDepositorAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM200
Plasmid#227659PurposepRS305 3XFLAG-HRV3C-Rpn5 WTDepositorAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pDestTol2-QUAS:GFP-CAAX-he1.1:YFP
Plasmid#184816PurposeUsed to generate the Tg(QUAS:GFP-CAAX; he1.1:YFP)c631 transgenic lineDepositorInsertQUAS:GFP-CAAX-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsGFP-CAAXAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDR274-gsc2-sgRNA
Plasmid#184818PurposeUsed to synthesize gRNA targeting exon 2 of the gsc2 geneDepositorInsertgsc2-sgRNA
UseCRISPR; Template for sgrna synthesisAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pDestTol2-QUAS:NLS-mApple-he1.1:CFP
Plasmid#184814PurposeUsed to generate the Tg(QUAS:NLS-mApple; he1.1:CFP)c718 transgenic lineDepositorInsertQUAS:NLS-mApple-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsNLS-mAppleAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-QUAS:NLS-GFP-he1.1:CFP
Plasmid#184815PurposeUsed to generate the Tg(QUAS:NLS-GFP; he1.1:CFP)c682 transgenic lineDepositorInsertQUAS:NLS-GFP-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsNLS-GFPAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only