We narrowed to 10,234 results for: Uty
-
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_VPEVS
Plasmid#105863PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_ILGGP
Plasmid#105855PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2charge
Plasmid#105852PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutations modify charge of CH2 domain.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1, muatations: Gl…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1538
Plasmid#82431PurposePlasmid for expression of NHA-tagged human-Nematostella GW182 11W11A chimera in mammalian cellsDepositorInserths-nvGW182 11W11A chimera
TagsNHAExpressionMammalianMutationaa 1-1169 of siRNA resistant hsTNRC6A (Q8NDV7-2) …PromoterCMVAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
Progerin-S22D-CS-pLPC
Plasmid#73810PurposeProgerin mutant where Serine 22 is mutated to aspartic acid and where there is a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with substitution of cysteine in CaaX-mo…PromoterCMVAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC-S22AProgerin-CS
Plasmid#69063Purposeencodes a Progerin mutant with serine 22 mutated to an alanine and with a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with serine 22 mutated to alanine and wi…PromoterCMVAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
tdEos-EB3-7
Plasmid#57610PurposeLocalization: MT End Binding Protein, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceJan. 16, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
DRH001_scAAV-hSyn-iCre-HA
Plasmid#225086PurposeExpression of iCre with an HA tag in neurons driven by human synapsin promoter.DepositorInsertiCre
UseAAV and Cre/LoxTagsHAExpressionMammalianPromoterhSynAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT4-U6-sgRNA-CMV-EGFP
Plasmid#239587PurposeSleeping-beauty based EV for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseSleeping beauty transposoneExpressionMammalianPromoterhU6Available SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
SB-CAG-mCherry-P2A-EIF3D-NN-IP
Plasmid#236771PurposeA sleeping beauty-based vector containing CAG promoter-driven mCherry-P2A-EIF3D S528N/S529N-IRES-Pac.DepositorInsertEIF3D (EIF3D Human)
UseSleeping beautyExpressionMammalianMutationchanged Serine 528 to Asparagine and Serine 529 t…PromoterCAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6b
Plasmid#207852PurposeMammalian expression of PE6b prime editorDepositorInsertPE6b
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-His6-ERK2-MEK1_R4F_coexpression
Plasmid#39212DepositorTagsHis6 and RBSExpressionBacterialMutationMEK1(R4F) = S218E, S222D and deletion of AA32-51PromoterT7 and T7 via RBSAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W
Plasmid#67980PurposeCas9 activity reporter with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Archon1-EGFP
Plasmid#108417PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-EGFP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSE2ss-CLIg-mK_M18
Plasmid#82358PurposeExpression plasmid coding for kappa light chain of mouse antibody specific to antigen B of the ABO blood group system, clone M18.DepositorInsertTagsnoneExpressionMammalianPromoterhEF1-HTLV promAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4A
Plasmid#224448PurposeRep/Cap plasmid for the production of MyoAAV 4A, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYNSL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV2A
Plasmid#224440PurposeRep/Cap plasmid for the production of MyoAAV 2A, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDQTTL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only