We narrowed to 25,649 results for: multi
-
Plasmid#84742PurposeExpresses huLbCpf1 and crRNA guideDepositorInserthuLbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMVAvailable sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FRE5Cf
Plasmid#62378PurposeDerived from FRE5. A two nucleotide insertion to shift the reading frame to dsRED.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdsRed and GFP
ExpressionMammalianAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNTI647 dCas9-Mxi1 TetR KanMX
Plasmid#139474PurposeIntegrates CRISPRi effector and tet-responsive regulatorDepositorInsertsdCas9-Mxi1
Tet Repressor
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1 and pTEF1Available sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDNA5/FRT/TO_H2B_HaloTag7
Plasmid#169329PurposeExpression of H2B-HaloTag7 in mammalian cellsDepositorAvailable sinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_Dual_SNF2L-opt_p48
Plasmid#102243PurposeExpression of human codon optimized human SNF2L and pRbAp48 from pFastBac dualDepositorExpressionInsectMutationcodon optimized for expressionPromoterPolyhedrin and p10Available sinceNov. 1, 2017AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pY027
Plasmid#84742PurposeExpresses huLbCpf1 and crRNA guideDepositorInserthuLbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMVAvailable sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FRE5Cf
Plasmid#62378PurposeDerived from FRE5. A two nucleotide insertion to shift the reading frame to dsRED.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdsRed and GFP
ExpressionMammalianAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
iRFP-H2A
Plasmid#158691PurposeThis plasmid encodes an iRFP fused to H2A histone nuclear marker. It has CMV promoter driving the expression of iRFP fused to H2A. It has no selection markersDepositorInsertiRFP670
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_Dual_SNF2L-opt_p48
Plasmid#102243PurposeExpression of human codon optimized human SNF2L and pRbAp48 from pFastBac dualDepositorExpressionInsectMutationcodon optimized for expressionPromoterPolyhedrin and p10Available sinceNov. 1, 2017AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pActin-miRFP670nano
Plasmid#127428PurposeHuman beta-actin labeling with near-infrared fluorescent protein miRFP670nanoDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmiRFP670nano-human beta-actin
TagsmiRFP670nanoExpressionMammalianPromoterCMVAvailable sinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgCD71-2
Plasmid#46918PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CD71 geneDepositorInsertsUseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pSFS2A-CaHygB
Plasmid#189564PurposeCaHygB hygromycin resistance gene in the pSFS2A flipper backbone for genetic manipulation of Candida albicansDepositorInsertHygB
ExpressionYeastAvailable sinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBTR(hCc)
Plasmid#61026PurposeExpresses horse holocytochrome c in E. coliDepositorAvailable sinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
wt 6XHis-SNX9 pET15b
Plasmid#34690DepositorInsertSorting nexin 9
Tags6xHisExpressionBacterialAvailable sinceJan. 31, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgCD71-2
Plasmid#46918PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CD71 geneDepositorInsertsUseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pUCM-CLYBL-NGN2-BRN3A
Plasmid#165597PurposeDonor construct for insertion of NGN2 and BRN3A into the CLYBL safe harbor site. This is an all-in-one doxycycline-inducible construct, enabling iPSC differentiation into peripheral sensory neurons.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsUseCRISPR and TALENExpressionMammalianPromoterCAG, EF-1alpha, Endogenous CLYBL (splice acceptor…Available sinceMarch 3, 2021AvailabilityAcademic Institutions and Nonprofits only