We narrowed to 12,126 results for: LEA
-
Plasmid#222099PurposeFor expression of a mutant bacterial gasdermin (bGSDM) encoded by a Vitiosangium species with a thrombin protease cleavage site for controlled activation.DepositorInsertVitiosangium-bGSDM-thrombin ORF
Tags6xHis-SUMO2ExpressionBacterialMutationN-terminal methionine deleted and replaced by sin…PromoterT7Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: ATCAGTGATAGAGAACGTATGAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(EF1a no GFP) mnuctdTomato
Plasmid#172342PurposemnuctdTomatoDepositorInsertsmonomeric nuclear Tomato
HygR
UseLentiviral and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterEF1alphaAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-PACT-mOrange2-hCM1
Plasmid#196868PurposeExpression of Pericentrin-AKAP450 centrosomal targeting (PACT) domain fused to mOrange2 and human (h) Centrosomin motif 1 (CM1). PACT targets CM1 to the centrosomeDepositorInsertPACT-mOrange2-hCM1 (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-128-425-Akap9
Plasmid#196871PurposeExpression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to AcGFP. Used to displace endogenous Akap9 from GolgiDepositorInsertAcGFP-Akap9 (128-425) (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mOrange2-hCM1
Plasmid#196863PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Nedd1) fused to mOrange2 and human (h) Centrosomin motif 1 (CM1). Nedd1 targets CM1 to the centrosome to activate gamma-TuRCDepositorInsertNedd1-mOrange2-hCM1 (Nedd1 Rat, Human)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-Ubc9-K14R
Plasmid#185759PurposeBacterial expression of His6-Ubc9-K14RDepositorInsertSUMO-conjugating enzyme UBC9 (UBE2I Human)
TagsThrombin-cleavable His6-tagExpressionBacterialMutationK14RPromoterT7Available SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGK415-phlTA2-1E
Plasmid#165970PurposeExpresses phlTA(2-1E) mutantDepositorInsertphlF
UseSynthetic BiologyTagsNuclear localization signal and three copies of V…ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143K, codon-optimi…PromoterpPGK1 mutantAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
TTVTFLPTPSLILQT_epitope
Plasmid#165021PurposeExpression of CMV UL44 (38-52) fused to CD74DepositorInsertCMV UL44 (38-52)
UseLentiviralTagsCD74 at N-term; cathepsin S cleavage site (GRWHTV…ExpressionMammalianPromoterCMVAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4046348
Plasmid#149108PurposeYeast Expression plasmid for SARS-CoV-2 nsp6DepositorInsertSARS-CoV-2 nsp6 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Budding Yeast)
TagsCleavable thrombin;3xFLAGExpressionYeastMutationSaccharomyces cerevisiae recode 1PromoterpGAL1Available SinceMay 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046233
Plasmid#149032PurposeYeast Expression plasmid for SARS-CoV-2 nsp3DepositorInsertSARS-CoV-2 nsp3 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Budding Yeast)
TagsCleavable thrombin;6xHISExpressionYeastMutationSaccharomyces cerevisiae recode 1PromoterpTEF1Available SinceMay 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL90-Nat-2xHO
Plasmid#139069PurposeCRISPR/Cas9 engineering of the HO endonuclease gene with nourseothricin selectionDepositorInsertTwo guide RNAs targeting the HO endonuclease
ExpressionBacterial and YeastPromoterTDH3Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4046390
Plasmid#148996PurposeYeast Expression plasmid for SARS-CoV-2 nsp3DepositorInsertSARS-CoV-2 nsp3 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Budding Yeast)
TagsCleavable thrombin;3xFLAGExpressionYeastMutationSaccharomyces cerevisiae recode 1PromoterpTEF1Available SinceMay 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046207
Plasmid#145559PurposeYeast Expression plasmid for SARS-CoV-2 nsp6DepositorInsertSARS-CoV-2 nsp6 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Budding Yeast)
TagsCleavable thrombin;6xHISExpressionYeastMutationSaccharomyces cerevisiae recode 1PromoterpGAL1Available SinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046376
Plasmid#145481PurposeYeast Expression plasmid for SARS-CoV-2 N (nucleocapsid)DepositorInsertSARS-CoV-2 N (nucleocapsid) (N Severe acute respiratory syndrome coronavirus 2, Budding Yeast)
TagsCleavable thrombin;3xFLAGExpressionYeastMutationwtPromoterpTEF1Available SinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCK354
Plasmid#129698PurposeFor insulated expression in Synechocystis 6803. As pCK306 (rhaBAD rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites) + terminator ECK120010799DepositorInsertsPrhaBAD
yfp
rhaS
Terminator ECK120010799
ExpressionBacterialAvailable SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMH-HT_SsCHAD-H29A-R32A-R36A-R69A
Plasmid#127787PurposeExpresses a SsCHAD mutant protein in E. coli cellsDepositorInsertSsCHAD (SULM_RS11045 Sulfolobus solfataricus)
Tags6xHis tag + TEV cleavage siteExpressionBacterialMutationmutations in His29, Arg32, Arg36 and Arg69 to AlaAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1076 - prRosa26v1 LSL FLAG-SpCas9n NeoR
Plasmid#113162PurposeA donor plasmid with homologous arms matching rat Rosa26 and expressing a Cre-dependent FLAG-tagged SpCas9n and a NeoR selectable markerDepositorInsertSpCas9
TagsFLAGExpressionMammalianMutationD10APromoterCAGAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2
Plasmid#113945Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutininDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839PromoterCMVAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only