We narrowed to 7,945 results for: Lif;
-
Plasmid#73164Purposemulti-cistronic Vector for expression for Fly_FUCCI probes in insect cellsDepositorTagsmRFP1, GFPExpressionInsectMutationCyclin B Fragment aa 1-266 & E2F1 Fragment aa…Available SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pOPINB-M1-di-Ub(G76V)-HOIL-1
Plasmid#229539PurposeConstitutively active M1-di-ubiquitin HOIL-1 fusion protein for expression in E. coliDepositorTags6xHis-3CExpressionBacterialMutationChanged Gly 76 to Val and changed Gly 76 to ValPromoterT7Available SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-1 in pcDNAI/Amp
Plasmid#54468PurposeAn amino-terminal YFP fragment was fused to Gbeta-1. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP (1-158)/beta-1 (GNB1 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-1 was amplified via PCR, which removed an i…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWZL Sox2
Plasmid#26351DepositorAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
AiP5002 RabV-SADdeltaG-histone-EGFP
Plasmid#176284PurposeRecombinant rabies virus expressing histone-EGFPDepositorAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBABE FoxE1
Plasmid#26350DepositorAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZL Sox2 R74P
Plasmid#26355DepositorAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP5003 pAAV-Syn-DIO-TVA66T-dTom-CVS-N2cG
Plasmid#176285PurposeCre-dependent AAV virusDepositorInsertTVA66T-dTomato-rabies Glycoprotein
TagsdTomatoExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP5005 pAAV-Syn-DIO-TVA66T-dTom-SAD-B19G
Plasmid#176287PurposeCre-dependent AAV virusDepositorInsertTVA66T-dTomato-rabies Glycoprotein
TagsdTomatoExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP5001 RabV-CVS-N2cdeltaG-histone-EGFP
Plasmid#176283PurposeRecombinant rabies virus expressing histone-EGFPDepositorAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pInducer(p20) x mKate2-NLS-P2A-HRas(N17)_ires-puro
Plasmid#167832PurposeInducible expression of dominant negative HRas(N17) and P2A-coupled reporter mKate2-NLSDepositorAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP5004 pAAV-Syn-DIO-TVA-dTom-SAD-B19G
Plasmid#176286PurposeCre-dependent AAV virusDepositorInsertTVA-dTomato-rabies Glycoprotein
TagsdTomatoExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
HCT131_rAAV-eHGT_1498m-minBglobin-SYFP2-WPRE3-BGHpA
Plasmid#223931PurposeDirect-expressing SYFP2 AAV virusDepositorInsertSYFP2
UseAAVMutationN/APromoterminBglobinAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-5545 ∆cosδε
Bacterial Strain#209018PurposeDeficient in the P2 bacteriophage packaging cos site and encoding rhamnose-inducible P4 delta (δ) and epsilon (ε) genesDepositorBacterial ResistanceHygromycinSpeciesEscherichia coliAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP14871: pAAV-AiE0779m_3xC2-minBG-RiboL1-jGCaMP8s-WPRE3-BGHpA (Alias: CN4871) (AAV1)
Viral Prep#214865-AAV1PurposeReady-to-use AAV1 particles produced from AiP14871: pAAV-AiE0779m_3xC2-minBG-RiboL1-jGCaMP8s-WPRE3-BGHpA (Alias: CN4871) (#214865). In addition to the viral particles, you will also receive purified AiP14871: pAAV-AiE0779m_3xC2-minBG-RiboL1-jGCaMP8s-WPRE3-BGHpA (Alias: CN4871) plasmid DNA. Neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8s under the minBG promoter. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP15571: pAAV-AiE1426m-minBG-iCre(R297T)-BGHpA (Alias: CN5571) (AAV2)
Viral Prep#230877-AAV2PurposeReady-to-use AAV2 particles produced from AiP15571: pAAV-AiE1426m-minBG-iCre(R297T)-BGHpA (Alias: CN5571) (#230877). In addition to the viral particles, you will also receive purified AiP15571: pAAV-AiE1426m-minBG-iCre(R297T)-BGHpA (Alias: CN5571) plasmid DNA. minBG-driven expression of iCre(R297T) in striatal Sst-Chodl interneurons. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP15646: pAAV-AiE1426m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN5646) (AAV2)
Viral Prep#230884-AAV2PurposeReady-to-use AAV2 particles produced from AiP15646: pAAV-AiE1426m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN5646) (#230884). In addition to the viral particles, you will also receive purified AiP15646: pAAV-AiE1426m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN5646) plasmid DNA. minBG-driven expression of SYFP2 in cortical and striatal Sst-Chodl neurons. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP13738 - pAAV-AiE0743m_3xC2-minBG-tdTomato-WPRE3-BGHpA (Alias: CN3738) (AAV2)
Viral Prep#224173-AAV2PurposeReady-to-use AAV2 particles produced from AiP13738 - pAAV-AiE0743m_3xC2-minBG-tdTomato-WPRE3-BGHpA (Alias: CN3738) (#224173). In addition to the viral particles, you will also receive purified AiP13738 - pAAV-AiE0743m_3xC2-minBG-tdTomato-WPRE3-BGHpA (Alias: CN3738) plasmid DNA. minBG-driven expression of tdTomato in striatal cholinergic neurons. These AAV preparations are suitable purity for injection into animals.DepositorTagstdTomatoAvailable SinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP13780: pAAV-AiE0743m_3xC2-minBG-iCre(R297T)-BGHpA (Alias: CN3780) (AAV2)
Viral Prep#214848-AAV2PurposeReady-to-use AAV2 particles produced from AiP13780: pAAV-AiE0743m_3xC2-minBG-iCre(R297T)-BGHpA (Alias: CN3780) (#214848). In addition to the viral particles, you will also receive purified AiP13780: pAAV-AiE0743m_3xC2-minBG-iCre(R297T)-BGHpA (Alias: CN3780) plasmid DNA. Expression of iCre(R297T) in striatal cholinergic neurons under the minBG promoter. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only