We narrowed to 9,782 results for: crispr plasmids
-
Plasmid#217425PurposeHomology arms and mEGFP sequence for C-terminus tagging of human cadherin 5DepositorInsertCDH5 Homology Arms with mEGFP (CDH5 Human)
UseCRISPR; Donor templateTagsmEGFPMutationhomology arms contain point mutations to disrupt …Available SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAN007
Plasmid#220048PurposeReporter plasmid that encodes for the GFP fused to an N-terminal flag-HA epitope. A stop codon is inserted between the epitope tag and the gfp sequence to terminate GFP translation.DepositorInsertflag-HA-stop-GFP
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN013
Plasmid#220050PurposeReporter plasmid that expresses GFP and firefly luciferase linked with a viral 2A peptide. A stop codon is inserted at the 3'-end of the gfp gene, which permits GFP, but not luciferase expression.DepositorInsertGFP-stop-fLuc
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJUMP18-dCas9_O
Plasmid#127028PurposeBasic Part O- ORF; Catalytically dead mutant of the Cas9 from Streptococcus pyogenes.DepositorInsertPart dCas9_O
UseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJuly 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:IL2_SigP:NLuc
Plasmid#197266PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human IL2 locus (exon 3). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertInterleukin-2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-v2_SigP:NLuc
Plasmid#197268PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (long isoform only). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-v2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-total_SigP:NLuc
Plasmid#197267PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (both isoforms). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-total homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA
Plasmid#47108PurposeExpresses a S. pyogenes Cas9/dCas9 guide RNA in mammalian cellsDepositorHas ServiceCloning Grade DNAInsertSPgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX601-mCherry
Plasmid#84039PurposeStaphylococcus aureus (SaCas9) conjugated with mCherryDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-mCherryExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_zeo backbone
Plasmid#61427Purpose3rd generation lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_puro backbone
Plasmid#73795Purpose3rd generation lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CBE4max-SpG-P2A-EGFP (RTW4552)
Plasmid#139998PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpG(D10A/D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized CBE4max SpCas9 variant named SpG with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpG=D1135L/S1136W/G1218K/E1219Q/R13…PromoterCAGAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-P2-SpCas9
Plasmid#232354PurposeThe plasmid pBBR1-P2-SpCas9 employs pBBR1MCS-2 as the vector, with Cas9 protein derived from S. pyogenes and the stationary phase promoter P2 sourced from S. marcescens HBQA7.DepositorInsertsCas9
sacB
UseCRISPRPromoterpromoter P2 from S. marcescens HBQA7Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cloning template vector
Plasmid#131471PurposeCloning template form ORANGE method based knock-in constructsDepositorTypeEmpty backboneTagsHAExpressionMammalianPromoterU6 and CbhAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230 (LbCpf1)
Plasmid#86210PurposeLbCpf1 Gateway entry plasmidDepositorInsertLbCpf1
UseCRISPR; Gateway compatible lbcpf1 entry cloneTags5' and 3' NLSExpressionPlantAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_puro optimized backbone
Plasmid#73797Purposeoptimized lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMK1334
Plasmid#127965PurposesgRNA expression vector compatible with CROP-Seq and imaging screensDepositorInsertEF1a-Puro-T2A-2xmycNLS-WPRE-mU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceAug. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti SYN-dCas9-KRAB-MeCP2
Plasmid#155365PurposeExpresses dCas9-KRAB-MeCP2 fusion driven by human SYN promoterDepositorInsertdCas9-KRAB-MeCP2
UseCRISPR and LentiviralTags3x FLAG and 7x HisExpressionMammalianPromoterSYNAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dzCas9-Act3.0
Plasmid#158414PurposeCRISPR-Act3.0 system containing dzCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdzCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only