We narrowed to 17,413 results for: ESP
-
Plasmid#21854DepositorInsertATF4 (Atf4 Mouse)
TagsEGFPExpressionMammalianMutationVector derived viral termination and poly-adenyla…Available SinceSept. 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
CoV-2-NSP3-c002
Plasmid#173084PurposeExpression of recombinant fusion protein in E. coliDepositorInsertrep (ORF1ab Severe acute respiratory syndrome coronavirus 2 (2019-nCoV) (SARS-CoV-2))
ExpressionBacterialMutationE1084-E1192, codon optimizedAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLK1 G5.1 gRNA
Plasmid#90834Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorInsertPLK1 (Guide Designation G5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2.1-NLS(sv40) (BPK5059)
Plasmid#115137PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-p160C
Plasmid#46DepositorInsertp160 myb binding protein (Mybbp1a Mouse)
TagsmycExpressionMammalianMutationexpresses aa580-1330Available SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLX302-MKP7-V5 puro
Plasmid#87771PurposeExpresses V5 tagged human MAPK phosphatase 7 (MKP7/DUSP16)DepositorAvailable SinceMarch 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
NAE1 G7.3 gRNA
Plasmid#90776Purpose3rd generation lentiviral gRNA plasmid targeting human NAE1DepositorInsertNAE1 (Guide Designation G7.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc Separase C2029A
Plasmid#59822PurposeAllows the integration of myc Separase C2029A in the genome and Tet-inducible expressionDepositorInsertSeparase (ESPL1 Human)
TagsMycExpressionMammalianMutationC2029APromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Myc-Cdh1
Plasmid#28127DepositorAvailable SinceMarch 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-DVC1-Strep-HA
Plasmid#113481PurposeExpression of human DVC1 with C-terminal strep-HA tagDepositorInsertDVC1 (SPRTN Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
PSMD14 E6.4 gRNA
Plasmid#90859Purpose3rd generation lentiviral gRNA plasmid targeting human PSMD14DepositorInsertPSMD14 (Guide Designation E6.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATAD2 D7.3 gRNA
Plasmid#90538Purpose3rd generation lentiviral gRNA plasmid targeting human ATAD2DepositorInsertATAD2 (Guide Designation D7.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
BCL6-H2Kk-RV (H2K-BCL6)
Plasmid#40352DepositorAvailable SinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-sfGFP-GMRWhite
Plasmid#165907PurposeBlasticidin resistant 5xUAS sfGFP GMR-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLK1 G6.1 gRNA
Plasmid#90835Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorInsertPLK1 (Guide Designation G6.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pENTR4_CELF1
Plasmid#106098PurposeEntry vector for CELF1DepositorInsertCELF1 (CELF1 Human)
UseGateway entry vectorAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Casp8
Plasmid#48172Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsert5" UTR of CASP8 (CASP8 Human)
UseLuciferaseAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only