We narrowed to 6,411 results for: kit
-
Plasmid#121057PurposemKate2^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertmKate2-T^SEC^AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, C. elegans codon optimized mKate2, and au…ExpressionWormMutationPromoterAvailable sinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOD2048-csnDEG
Plasmid#89368PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression controlled by Posm-6 (ciliated sensory neuron specific)DepositorInsertvhhGFP4-ZIF-1 (zif-1 Synthetic, Nematode)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)ExpressionMutationPromoterPosm-6Available sinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
JWW-1 human chimeric antibody
Plasmid#66748PurposeExpresses a rat/human chimeric IgG1 HPV16 L2-specific neutralizing antibody that recognizes HPV16 L2 amino acid region 17-36. JWW-1 works in ELISA/WB/HPV Neutralization assay.DepositorInsertsJWW-1 Heavy Chain Gamma
JWW-1 Light Chain Kappa
UseTagsExpressionMammalianMutationFirst 3 amino acids of rat light chain constant r…PromotermEF1 and rEF1Available sinceJuly 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJW1583
Plasmid#121054PurposeGFP^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertGFP^SEC^AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, C. elegans codon optimized GFP, and auxin…ExpressionWormMutationPromoterAvailable sinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-ChR2-YFP
Plasmid#178721PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LMPd Ametrine Got2 shRNA#3
Plasmid#220593PurposeRetroviral vector with Ametrine marker for expression shRNA with an "UltramiR" microRNA scaffoldDepositorInsertGot2 shRNA (Got2 Mouse)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-hHDAC4-tagBFP-PGK-Blasticidin
Plasmid#187954PurposeFKBP12 (F36V mutant) degron-tagged dCas9-hHDAC4 fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-hHDAC4-tagBFP
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-TagRFP658-P2A-GFP
Plasmid#178971PurposeExpresses TagRFP658 and GFP in mammalian cellsDepositorInsertTagRFP658-P2A-GFP
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pJW1584
Plasmid#121055PurposeYPET^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertYPET^SEC^AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, C. elegans codon optimized YPET, and auxi…ExpressionWormMutationPromoterAvailable sinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1a-BFPCDK6-W
Plasmid#208756PurposeLentiviral vector expressing BFP fused with CDK6 cDNADepositorInsertCDK6 (CDK6 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
DHC1 CRISPR
Plasmid#140545PurposeDHC1 tagging CRISPRDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-ChR2-YFP
Plasmid#178725PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAC-CLEC4D
Plasmid#172411PurposeMAC-tagged gene expressionDepositorInsertC-type lectin domain family 4 member D (CD antigen CD368) (CLEC4D Human)
UseTagsMAC-tagExpressionMammalianMutationPromoterCMV promoterAvailable sinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-mGFAP(ABC1D)-2pabPAC
Plasmid#234547Purposeto express the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC
UseAAVTagsExpressionMutationNonePromotermGFAP(ABC1D)Available sinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFB-GST-FBXO22
Plasmid#228367Purposeexpress human FBXO22 in insect cells, such as Trichoplusia ni Hi5DepositorInsertFBXO22 (FBXO22 Human)
UseTagsGSTExpressionInsectMutationPromoterAvailable sinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFB-His-SKP1
Plasmid#228368Purposeexpress human SKP1 in insect cells, such as Trichoplusia ni Hi5DepositorInsertSKP1 (SKP1 Human)
UseTagsHisExpressionInsectMutationPromoterAvailable sinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACE-MBP-FBXL17 (310–701)
Plasmid#228369Purposeexpress human FBXL17 in insect cells, such as Trichoplusia ni Hi5DepositorInsertFBXL17 (FBXL17 Human)
UseTagsMBPExpressionInsectMutationPromoterAvailable sinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-FBXO22
Plasmid#232271PurposeExpression of N-terminal tagged HA-FBXO22 (H. sapiens) in human cell linesDepositorInsertFBXO22 (FBXO22 Human)
UseTagsHAExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only