We narrowed to 1,287 results for: AAV Cas9
-
Plasmid#177347PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterCMVAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-AlbEx14-mNG
Plasmid#201780Purposeknocks in mNeonGreen into exon 14 of Alb to produce Alb-mNeonGreen fusion protein in miceDepositorUseAAV and CRISPRTagsExpressionMutationPromoterU6Available sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97311PurposeMMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb MMEJ donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3AL_bGHpA
Plasmid#177354PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_AAVS1-T2
Plasmid#41818PurposeExpresses a guide RNA (gRNA) to target human AAVS1 (T2 target sequence) for genome engineeringDepositorInsertgRNA_AAVS1-T2
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
gRNA_AAVS1-T1
Plasmid#41817PurposeExpresses a guide RNA (gRNA) to target human AAVS1 (T1 target sequence) for genome engineeringDepositorInsertgRNA_AAVS1-T1
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Neo-CAG-Flpe-ERT2
Plasmid#68460PurposeAAVS1 targeting donor plasmid with Flpe-ERT2 expression cassette and Neo selection geneDepositorInsertmammalian-codon-optimized Flpe recombinase fused with ERT2
UseSynthetic BiologyTagsERT2ExpressionMammalianMutationPromoterCAGAvailable sinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgCTG-CMV-GFP
Plasmid#216734PurposeAAV plasmid containing sgCTG (target sequence: (CUG)6) driven by a U6 promoter and eGFP under the control of the CMV promoter. Used for in vivo experiments.DepositorArticleInsertsgCTG
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6 and CMVAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR
Plasmid#68347PurposeAAV plasmid expressing the FlpO recombinase. with empty gRNADepositorInsertFlPO
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV_S34F_U2AF1
Plasmid#176592PurposeAdenoviral construct to change S to F at 34th amino acid (S34F) in human U2AF1DepositorInsertU2AF1 (U2AF1 Human)
UseAAVTagsExpressionMutationPromoterAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPPC010.AAV
Plasmid#171175PurposeExpression of Sp.pCas9-dCas9, BBa_J23107-MCP-SoxS(R93A/S101A), and hAAVS1 scRNA on pBBR1-KmR plasmidDepositorInsertshAAVS1 scRNA
Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRTagsExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterBBa_J23119 and Sp.pCas9, BBa_J23107Available sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-DRGFP
Plasmid#113193PurposeDR-GFP substrate (Addgene #26475) flanked by human AAVS1 homology arms. Endogenous AAVS1 promoter drives T2A-hygromycin expression after integration. DR-GFP cassette contains PGK-puromycin.DepositorInsertDR-GFP
UseDonor construct with t2a-hygromycin for gene trap…TagsExpressionMammalianMutationPromoterAvailable sinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mTubb3
Plasmid#87116PurposeAAV backbone plasmid including GFP knock-in donor and Tubb3gRNA for HITIDepositorInsertU6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV_K700E_hSF3B1
Plasmid#176591PurposeAdenoviral construct to change K to E at 700th amino acid (K700E) in human SF3B1DepositorInsertSF3B1 (SF3B1 Human)
UseAAVTagsExpressionMutationPromoterAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only