We narrowed to 6,060 results for: cat.2
-
Plasmid#192996PurposePlasmid that encodes for Hydra Sp5, lacking the SP box and DNA binding domainDepositorInsertHydra Sp5
TagsHAExpressionMammalianMutationno SP box and DNA binding domainAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
HyWnt3-ΔRep:Luc
Plasmid#192987PurposePlasmid to test the Hydra Wnt3 promoter activity (full deletion of the repressor element)DepositorInsertHydra Wnt3 promoter
ExpressionMammalianMutationRepressor element deletedAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA5
Plasmid#180366Purposetargeting mouse Arkadia geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA6
Plasmid#180367Purposetargeting mouse Arkadia geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA3
Plasmid#180364Purposetargeting mouse Arkadia geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_SMO
Plasmid#183321PurposeAll-in-One CRISPRko system with a guide RNA that targets SMO geneDepositorInsertSMO
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC53
Plasmid#209962PurposeContains Level 0 Part: 5' Connector (5C1CSN with double terminator Tcat+sai) for the construction of Level 1 plasmidsDepositorInsert5' Connector (5C1CSN_Tcat+sai)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
CL20_mEGFP_LCLAT1_GREB10
Plasmid#205845PurposeExpress mEGFP-tagged fusion protein, LCLAT1_GREB1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKT07_AAV-hU6-AsDR-EFS-Cre-T2A-hNGFR
Plasmid#256629PurposeAAV vector for delivery of AsCas12a guides and expressing Cre and hNGFR using EFS promoterDepositorTypeEmpty backboneUseAAVAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGMC00003
Plasmid#166720PurposesgRNA against mouse KitlDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1D
Plasmid#183340PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1D
UseLentiviralAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_NTC3
Plasmid#183335PurposeAll-in-One CRISPRko system containing a non-targeting controlDepositorInsertNTC3
UseLentiviralAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BRD4
Plasmid#183331PurposeAll-in-One CRISPRko system with a guide RNA that targets BRD4 geneDepositorInsertBRD4
UseLentiviralAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circNUDC_1
Plasmid#215232PurposeSupression of shcircNUDC(5,RI,6)_1 expressionDepositorInsertcircNUDC shRNA 1 (NUDC Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLPP4
Plasmid#209966PurposeContains Level 0 Part: constitutive Promoter (P40) for the construction of Level 1 plasmidsDepositorInsertPromoter (P40)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLP-EV
Plasmid#209973PurposeContains Level 0 Part: mock coding sequence (EV) for the construction of Level 1 plasmidsDepositorInsertCDS (mock)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG-sgRNA.FOXA-ZEB2_CRISPRd_v2
Plasmid#216173PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only