We narrowed to 6,415 results for: org
-
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOD2087-trnDEG
Plasmid#89369PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pmec-18 (touch neuron specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Synthetic, Nematode)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPmec-18Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-hMSN
Plasmid#211823PurposeExpress human MSN in mammalian cellsDepositorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CreLite
Plasmid#131785PurposeAAV donor/transfer vector expressing CreLite system components, PhyBΔCreC and PIF6CreN, driven by CBh promoterDepositorInsertPhyBCreC-P2A-PIF6CreN
UseAAV, Cre/Lox, and Synthetic BiologyExpressionMammalianPromoterCBhAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
K15-TK/pGL3
Plasmid#44267DepositorInsertK15 promoter (-4.8) (Krt15 Mouse)
UseMouse Targeting; Thymidine kinaseTagsHSV-1 TKExpressionMammalianMutationContains the murine K15 promoter (-4.8) fragmentPromotermurine K15 promoter (-4.8) fragmentAvailable SinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMEL14
Plasmid#107920PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-lincRNA-RoR-sh1 (Linc-sh1)
Plasmid#45764DepositorAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-lincRNA-RorR-sh2 (Linc-sh2)
Plasmid#45765DepositorAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTol2-PcyA-IRES-HO1
Plasmid#131787PurposeTol2 bicistronic vector expressing PcyA and HO1 for Phycocyanobilin (PCB) synthesis, driven by heatshock promoter hsp70.DepositorInsertPcyA and HO1
UseSynthetic Biology; Zebrafish tol2 transposonTagsMTS (Mitochondrial Targeting Signal from subunit …ExpressionMammalianPromoterhsp70Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-CDKL5(isoform-2)
Plasmid#245901PurposeMammalian expression of CDKL5 isoform2 (1-1030) with N-terminal GFPDepositorAvailable SinceNov. 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-CDKL5(kinase)
Plasmid#245902PurposeMammalian expression of CDKL5 kinase domain (1-311) with N-terminal GFPDepositorAvailable SinceNov. 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-CDKL5(isoform1)_L960D
Plasmid#245900PurposeMammalian expression of CDKL5 isoform1 (1-960) L960D with N-terminal GFPDepositorInsertCDKL5-2 (CDKL5 Human)
TagsGFP-AvitagExpressionMammalianMutationN8D, E569G, L960DPromoterCMVAvailable SinceOct. 23, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
CDKL5(isoform1)-GFP
Plasmid#245903PurposeMammalian expression of CDKL5 isoform1 (1-960) with C-terminal GFPDepositorAvailable SinceOct. 23, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pZac2.1-GfaABC1D-2xEzrin-BioID2-HA
Plasmid#227681PurposeTo over express 2x Ezrin under gfaABC1D promoter in astrocytesDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shAtg7-EGFP
Plasmid#227684PurposeExpresses EGFP and shRNA targeting Atg7DepositorInsertAtg7 shRNA (Atg7 Mouse)
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_DAZL_cterm2
Plasmid#222919PurposeCas9/sgRNA plasmid for targeting DAZLDepositorInsertCas9, DAZL sgRNA 2 (DAZL Human, Synthetic)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DAZL_cterm3
Plasmid#222920PurposeCas9/sgRNA plasmid for targeting DAZLDepositorInsertCas9, DAZL sgRNA 3 (DAZL Human, Synthetic)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only