We narrowed to 6,423 results for: org
-
Plasmid#101481PurposeDonor Vector containing ZNF716 transcription factor, part of the Human TFome CollectionDepositorInsertZNF716 (ZNF716 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRLsin.PPT.CMV‐GFP‐Eps8 WT
Plasmid#74922PurposeLentiviral plasmid expressing Eps8 fused to GFPDepositorAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF808
Plasmid#101470PurposeDonor Vector containing ZNF808 transcription factor, part of the Human TFome CollectionDepositorInsertZNF808 (ZNF808 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF442
Plasmid#101455PurposeDonor Vector containing ZNF442 transcription factor, part of the Human TFome CollectionDepositorInsertZNF442 (ZNF442 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-4
Plasmid#133404Purposehuman ETV6 gRNA-3 and 4 is a pair of gRNAs. Four ETV6 gRNA plasmids used the same backbone(Addgene plasmid#41824). ETV6 gRNA-4 target the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBABE MD-deltaN-ER
Plasmid#13496DepositorInsertMyoD1-Estrogen Receptor Fusion Protein (Myod1 Mouse, Human)
UseRetroviralExpressionMammalianMutationMyoD (containing a deletion in aa3-56) was fused …Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET-LiCre
Plasmid#219797PurposeExpresses a codon-optimized His-tagged Light-inducible Cre (LiCre) recombinase in E. coli. Plasmid ID in Yvert lab is pGY611. LiCre is described in https://doi.org/10.7554/eLife.61268DepositorInsertCodon-optimized Light-inducible Cre Recombinase
UseCre/LoxTagsHIS-tag for purificationExpressionBacterialPromoterIPTG-inducibleAvailable SinceMay 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab264-pcDNA3-BRCA1(1314-end)-M1783T-V5-3xFLAG
Plasmid#249017PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the M1783T mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationM1783TPromoterCMV PromoterAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab211-pcDNA3-BRCA1(1314-end)-L1705R-V5-3xFLAG
Plasmid#249015PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the L1705R mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationL1705RPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab240-pcDNA3-BRCA1(1314-end)-Y1845D-V5-3xFLAG
Plasmid#249016PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the Y1845D mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845DPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab981-pcDNA3-BRCA1(1314-end)-V1736A-V5-3xFLAG
Plasmid#249018PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the V1736A mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationV1736APromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab224-pcDNA3-BRCA1(1314-end)-R1699W-V5-3xFLAG
Plasmid#249019PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the R1699W mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationR1699WPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab223-pcDNA3-BRCA1(1314-end)-R1699Q-V5-3xFLAG
Plasmid#249020PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the R1699Q mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationR1699QPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab228-pcDNA3-BRCA1(1314-end)-S1715R-V5-3xFLAG
Plasmid#249021PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the S1715R mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationS1715RPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab189-pcDNA3-BRCA1(1314-end)-A1708E-V5-3xFLAG
Plasmid#249022PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the A1708E mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationA1708EPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab525-pcDNA3-3xFLAG-V5-BRCA1(1314-end)-WT-STOP
Plasmid#249008PurposeThis plasmid expresses the N-terminally 3x-FLAG tagged BRCT domainDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab521-pcDNA3-3xFLAG-V5-BRCA1(1314-end)-Y1845F-STOP
Plasmid#249009PurposeThis plasmid expresses the N-terminally 3x-FLAG tagged BRCT domain that contains the Y1845F mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845FPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab522-pcDNA3-3xFLAG-V5-BRCA1(1314-end)-Y1845D-STOP
Plasmid#249010PurposeThis plasmid expresses the N-terminally 3x-FLAG tagged BRCT domain that contains the Y1845D mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845DPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only