We narrowed to 13,949 results for: CRISPR-Cas9
-
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-sbcB-N
Plasmid#220290PurposeGateway entry plasmid (attL1& attR5) expressing sbcB exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertsbcB-XTEN linker-LbCas12a
UseCRISPR; Gateway compatible sbcb-xten linker- lbca…ExpressionPlantAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-sbcB-N
Plasmid#220305PurposeGateway entry plasmid (attL1& attR5) expressing sbcB exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertsbcB-XTEN linker-zSpCas9
UseCRISPR; Gateway compatible sbcb-xten linker- zspc…ExpressionPlantAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGMF6
Plasmid#242208Purpose35Sp::eGFP:35St cassette in L1 vector backbone. Expresses a nuclear localized eGFP protein for transient plant transformation.DepositorInsertLevel1 35Sp::eGFP:35St
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_268
Plasmid#231112PurposeSpG-Cas9DepositorInsertCas9-SpG
UseCRISPR and LentiviralAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMLS1272
Plasmid#188891PurposeRic-4 sgRNA expression vectorDepositorInsertPU6(R07E5.16)::Ric-4 sgRNA (CELE_Y22F5A.3 Nematode)
ExpressionWormAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-RGS8
Plasmid#140585PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA RGS8
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-GTPBP2
Plasmid#140586PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA GTPBP2
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
PV384
Plasmid#132344PurposeCas9 DsRed targeting sgRNA expression cassette for Zea maysDepositorInsertCas9 DsRed targeting sgRNA
ExpressionPlantAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG2
Plasmid#90277Purpose(also pMST620-BB3_gpyrG2_cas9) CRISPR/Cas9 plasmid with gRNA for site pyrG2, Cas9DepositorInsertgRNA (pyrg2)
UseA. nigerExpressionBacterialAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
NG-ABEmax
Plasmid#124163PurposeA-to-G base editorDepositorInsertTadA-TadA(evo)-Cas9-NG
ExpressionMammalianAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev2
Plasmid#81207Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for1
Plasmid#81210Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev1
Plasmid#81208Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only