We narrowed to 7,397 results for: mcherry
-
Plasmid Kit#1000000086PurposeCRISPR-assisted insertion tagging (CRISPaint) plasmid collection for modular integration of large DNA fragments into user-defined genomic locations via a ligase-4-dependent mechanism.DepositorApplicationGenome EditingVector TypeMammalian ExpressionEditing TypeCRISPRAvailable SinceSept. 28, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1-Hyg-NLS.EGFP.P2A.Cherry.CAAX
Plasmid#52421PurposeExpresses a polyprotein cleaved by peptide 2A into nuclear GFP and membrane located mCherryDepositorInsertFusion NLS-EGFP-P2A-Cherry-CAAX
ExpressionMammalianPromoterCMVAvailable SinceApril 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
Bidirectional MYC 5'UTR Dual Fluorescence Reporter
Plasmid#229498PurposeThis is a lentiviral reporter for translation initiation under the control of the Myc 5'UTR, which produces destabilized GFP (dsGFP). There is a control destabilized mCherry (dsmCherry) as a control.DepositorInsertMYC 5'Untranslated region + destabilized GFP
UseLentiviralExpressionMammalianPromoterEf1aAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
PC1575
Plasmid#232088PurposeMammalian expression plasmid for ubiquibody (uAb) cloning backbone. Includes an Esp3I restriction site directly upstream of GSGSG linker and CHIPΔTPR CDS and a C-terminal IRES-mCherry cassette.DepositorInsertuAb with cloning Esp3I restriction site
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pS12<ActB.mus_2A-mCh_KI-HMEJ
Plasmid#207407PurposeDonor template to knock in mCherry at the C-terminus of mouse ActB (β-Actin) using DSB repair by homology-mediated end joining (HMEJ). [Lab plasmid ID: TU148]DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pinducer 20 DN-KASH
Plasmid#125554PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationTruncated form: only the KASH domain of nesprin-…Promotertetracycline responsive elementAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
p37-2iDMD-LR
Plasmid#88892Purpose37°C full-length DMD luc-red plasmid. Co-expresses human dystrophin, firefly luciferase and mCherry in mammalian cells. Plasmid carries phiC31 and Bxb1 attB sites and can be grown at 37°C.DepositorInsertsExpressionMammalianAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iSAM
Plasmid#211495PurposeAAVS1 targeting vector containing an all-in-one DOX-inducible system for CRISPRaDepositorInsertsUniSAM insert
TET-ON
Neo Resistance
Insulator
UseCRISPR and Synthetic BiologyTagsT2A-mCherry TagExpressionMammalianPromoterEF1a, NA, Splicing acceptor, and TREGV promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Endo-INPP5E
Plasmid#236005PurposeEndosome-targeted inositol polyphosphate 5 phosphatase (INPP5E); hydrolyzes 5-phosphate in PI(3,4,5)P3 and PI(4,5)P2.DepositorInsertEndo-INPP5E (INPP5E Synthetic, Human)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
p28-2iDMD-puro
Plasmid#88895Purpose28°C full-length DMD luc-puro-red plasmid. Co-expresses human DMD, firefly luciferase, puroR and mCherry in mammalian cells. Plasmid carries phiC31 and Bxb1 attB sites, but *cannot* be grown at 37°C.DepositorInsertsExpressionMammalianMutationcodon optimizedAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-E-NoMi-P2A-CopGFP-T2A-PuroR
Plasmid#207805PurposeE-NoMi is a re-engineered tetraspanin scaffold tagged with bioluminescent and fluorescent reporter proteins under an EF-1α promoter.DepositorInsertE-NoMi
UseLentiviralTags3xFlag tag, copGFP, mCherry, and nanoluciferaseExpressionMammalianPromoterEF-1alphaAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro
Plasmid#31845PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression. Includes puromycin selection.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
yeast_DualReporter
Plasmid#127546PurposeA dual reporter vector modified from Sharon et al (Nature Biotech, 2012) containing Ura3 and Nat1 selectable markers, a constant background RFP (TEF2::mCherry), and a variable YFP (pTpA+MCS::yEVenus).DepositorInsertsUseSynthetic BiologyExpressionYeastPromoterTEF, TEF2, URA3, bla (E. coli), and pTpA+MCSAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-endo-GsCT
Plasmid#205516PurposeEndosome-targeted C-terminal fragment of human Gαs protein (Gαs inhibitory peptide).DepositorInsertendo-GsCT (GNAS Synthetic, Human)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-nuc-GsCT
Plasmid#205517PurposeNuclear-targeted C-terminal fragment of human Gαs protein (Gαs inhibitory peptide).DepositorInsertnuc-GsCT (GNAS Synthetic, Human)
TagsHistone H2A and mCherryExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh
Plasmid#31847PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherryAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Tol2-PA2-CMV-AB-mCh
Plasmid#160435PurposeExpresses human Amyloid Beta-mCherry in ZebrafishDepositorInsertHuman Amyloid Beta peptide (1-42) (APP Zebrafish, Human)
UseZebrafish expressionTagsmCherryPromoterCMVAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
UPRT-mCh-Nluc-P2A-neo-UPRT
Plasmid#135015PurposeExpresses mCherry protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum UPRT locusDepositorInsertsmCh-Nluc-P2A-neo
UPRT 5'UTR
UPRT 3'UTR
UseCryptosporidium expressionTagsmCherry and Nluc-neoPromoterCryptosporidium actin and enolaseAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP
Plasmid#61512PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIPDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP, Tom20, and mCherryExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only