We narrowed to 23,671 results for: Emb
-
Viral Prep#176761-AAV9PurposeReady-to-use AAV9 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8s (#176761). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8s plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pZac2.1-GfaABC1D-lck-jGCaMP8m (AAV5)
Viral Prep#176760-AAV5PurposeReady-to-use AAV5 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8m (#176760). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8m plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8m (AAV1)
Viral Prep#176760-AAV1PurposeReady-to-use AAV1 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8m (#176760). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8m plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8m (AAV9)
Viral Prep#176760-AAV9PurposeReady-to-use AAV9 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8m (#176760). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8m plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8s (AAV1)
Viral Prep#176761-AAV1PurposeReady-to-use AAV1 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8s (#176761). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8s plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8s. These AAV preparations are suitable purity for injection into animals.n into animals.DepositorPromoterGfaABC1DAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8f (AAV1)
Viral Prep#176759-AAV1PurposeReady-to-use AAV1 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8f (#176759). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8f plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX6p1-GST-Rnf31
Plasmid#63134PurposeExpression of human RNF31/HOIP codon optimized for E. coli and insect cellsDepositorInsertRnf31 (RNF31 Synthetic, Human)
TagsGSTExpressionBacterialMutationSynthetic based on human protein sequencePromotertacAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
6xHis-TEV-mCherry-LC3B-Gly (Microtubule-associated proteins 1A/1B light chain 3B)
Plasmid#169168PurposeConjugatable form of LC3B lacking 5 C-terminal amino acids (MKLSV), with C-terminal Glycine120 exposed for lipidation reaction.DepositorInsertMAP1LC3B (MAP1LC3B Human)
Tags6X Histidine Tag, TEV cleavage site, mCherryExpressionBacterialPromoterT7 lac promoterAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX6p1-Rbck1
Plasmid#63135PurposeExpression of human RBCK1/HOIL-1LDepositorInsertHOIL-1L (RBCK1 Synthetic, Human)
TagsGSTExpressionBacterialMutationSynthetic based on human protein sequencePromotertacAvailable SinceMarch 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAraGFP
Plasmid#39548DepositorInserteGFP
ExpressionBacterialAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAraTM
Plasmid#39547DepositorTypeEmpty backboneExpressionBacterialPromoterTacAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
KTD101(DE3)
Bacterial Strain#138651PurposeKTD101(DE3) is a trigger factor deficient strain, which may increase protein secretion from Escherichia coli, and is compatible with expression from the T7 promoterDepositorBacterial ResistanceNoneSpeciesEscherichia coliAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a AHU
Plasmid#26640DepositorInsertAHU
ExpressionBacterialAvailable SinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAraTM-2BTMCYwt
Plasmid#39549DepositorInsertIntegrin alpha2B TM-CYTO
ExpressionBacterialPromoterTacAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAraTM-2BTMCYL980A
Plasmid#39550DepositorInsertIntegrin alpha2B L980A TM-CYTO
ExpressionBacterialPromoterTacAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAraGFP
Plasmid#39548DepositorInserteGFP
ExpressionBacterialAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAraTM
Plasmid#39547DepositorTypeEmpty backboneExpressionBacterialPromoterTacAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only