We narrowed to 802 results for: sam
-
Plasmid#179977PurposeMammalian expression vector for SARS-CoV-2 E or bat RaTG13 E, V5-tagged (SARS-CoV-2 E and RaTG13 E have the same amino acid sequence and codon optimized sequence).DepositorAvailable sinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-FLAG-3C-ORF1_mClover3-TEV-ORF2
Plasmid#105801PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C or enterokinase; second protein expressed with mClover3, cleavable by TEV protease; tags positions: N-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: FLAG-3C; ORF2: mClover3-TEVExpressionMammalianAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-ALG13 (OTU, aa 216-353)
Plasmid#61414PurposeExpresses human ALG13 (OTU domain) in E. coli.DepositorInsertALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13) (ALG13 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-215 and aa 354-1137.PromoterT7Available sinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
6MIW
Plasmid#127291PurposeBacterial expression for structure determination. May not contain entire coding region of geneDepositorAvailable sinceJune 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
A0A0F4YNJ0
Plasmid#163220PurposeInducible expression of UniProt identifier A0A0F4YNJ0DepositorInsertA0A0F4YNJ0
Tags10xHis and T7ExpressionBacterialPromoterT7Available sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLRD25
Plasmid#208272PurposeProduction of cis-abienol in E. coli MEV20DepositorInsertstHMGR
abCAS
ExpressionBacterialAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLRD20
Plasmid#208271PurposeProduction of 13R-manoyl oxide in E. coli MEV20DepositorInsertstHMGR
abCAS
cfTPS3
ExpressionBacterialMutationabCAS(D537A)Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(46))-PGKpuroBFP-W
Plasmid#200504PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GNE
Plasmid#25255PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertGNE:T406-R720 (GNE Human)
TagsHisExpressionBacterialMutationContains amino acids T406-R720Available sinceAug. 13, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOET3-6xHis-hSMSr
Plasmid#236224PurposeExpress N-terminal His-tagged human SMSr (SAMD8) protein in insect cellsDepositorInsertSAMD8 (SAMD8 Human)
TagsHexa histidine tag (6xHis-tag) and enterokinase s…ExpressionInsectMutationwild typeAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-human GALNTL5-3xHA
Plasmid#241431PurposeThe nucleotides coding human GALNTL5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (GALNTL5 Human)
Tags3xHAExpressionMammalianPromoterCAGAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 variant #1-3xHA
Plasmid#240645PurposeThe nucleotides coding mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 (37 kDa)-3xHA
Plasmid#240646PurposeThe nucleotides coding 37 kDa from the C-terminus of mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 (30 kDa)-3xHA
Plasmid#240647PurposeThe nucleotides coding 30 kDa from the C-terminus of mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 (20 kDa)-3xHA
Plasmid#240648PurposeThe nucleotides coding 20 kDa from the C-terminus of mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 (10 kDa)-3xHA
Plasmid#240649PurposeThe nucleotides coding 10 kDa from the C-terminus of mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMSr-TEV-Twin-Strep
Plasmid#202530PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged human Sphingomyelin synthase-relate protein (SMSr) in mammalian cellDepositorInsertSAMD8 (SAMD8 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TGA)PromoterCAG and chicken β-actin promoterAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pN3
Plasmid#233520PurposeNb Vector Plasmid (under galactose induction), AmpR (E. coli) and HygroR (yeast), Cen6/ARSDepositorTypeEmpty backboneExpressionBacterial and YeastPromoterpGAL1Available sinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pY3
Plasmid#218116PurposeActivity reporter backbone with an empty protease cassette (BsaI) and an empty substrate cassette (BsmBI), both under a divergent pGAL1-10 promoter.DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only