We narrowed to 808 results for: sam
-
Plasmid#174683PurposeExpresses 6xHis-MBP tagged HkCas12aDepositorPublicationInserthuHkCas12a
UseCRISPR and Synthetic BiologyTags6xHis, MBP, TEV, NLS and NLS, 6xHis, 3xHAExpressionBacterialPromoterT7Available sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKK-RNAi-nucCHERRYmiR-EGFP-TEV
Plasmid#105810PurposeFunctional studies using RNAi; rescue experiments; substituting protein for its different form. miRNA cassette with nuclear mCherry expression marker; your protein of interest with N-terminal EGFP.DepositorTypeEmpty backboneUseRNAi; Flp-in competentTagsEGFP-TEVExpressionMammalianAvailable sinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(47))-PGKpuro2ABFP-W
Plasmid#200510PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(47) (SMARCA2 Human)
UseLentiviralAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(46))-PGKpuro2ABFP-W
Plasmid#200465PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(46) (SMARCA2 Human)
UseLentiviralAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
12x PRE TK luc
Plasmid#206163PurposeLuciferase reporter construct containing 12 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert12X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-FLAG-3C-ORF1_mClover3-TEV-ORF2
Plasmid#105801PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C or enterokinase; second protein expressed with mClover3, cleavable by TEV protease; tags positions: N-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: FLAG-3C; ORF2: mClover3-TEVExpressionMammalianAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBa.Halo-Kif13B tail 442-1843
Plasmid#162721PurposeMammalian expression of WT mouse Kif13b with deletion of the 441 N-terminal residuesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertKif 13B (Kif13b Mouse)
ExpressionMammalianMutationWT with deletion of the 441 N-terminal residues.PromoterChicken Beta actinAvailable sinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-ALG13 (OTU, aa 216-353)
Plasmid#61414PurposeExpresses human ALG13 (OTU domain) in E. coli.DepositorInsertALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13) (ALG13 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-215 and aa 354-1137.PromoterT7Available sinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV2/bat-CoV RaTG13 E C-V5-tag
Plasmid#179977PurposeMammalian expression vector for SARS-CoV-2 E or bat RaTG13 E, V5-tagged (SARS-CoV-2 E and RaTG13 E have the same amino acid sequence and codon optimized sequence).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSARS-CoV-2 E (E Synthetic)
ExpressionMammalianMutationhuman codon-optimizedAvailable sinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
6MIW
Plasmid#127291PurposeBacterial expression for structure determination. May not contain entire coding region of geneDepositorAvailable sinceJune 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
A0A0F4YNJ0
Plasmid#163220PurposeInducible expression of UniProt identifier A0A0F4YNJ0DepositorInsertA0A0F4YNJ0
Tags10xHis and T7ExpressionBacterialPromoterT7Available sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLRD25
Plasmid#208272PurposeProduction of cis-abienol in E. coli MEV20DepositorInsertstHMGR
abCAS
ExpressionBacterialAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(46))-PGKpuroBFP-W
Plasmid#200504PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLRD20
Plasmid#208271PurposeProduction of 13R-manoyl oxide in E. coli MEV20DepositorInsertstHMGR
abCAS
cfTPS3
ExpressionBacterialMutationabCAS(D537A)Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
GNE
Plasmid#25255PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertGNE:T406-R720 (GNE Human)
TagsHisExpressionBacterialMutationContains amino acids T406-R720Available sinceAug. 13, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOET3-6xHis-hSMSr
Plasmid#236224PurposeExpress N-terminal His-tagged human SMSr (SAMD8) protein in insect cellsDepositorInsertSAMD8 (SAMD8 Human)
TagsHexa histidine tag (6xHis-tag) and enterokinase s…ExpressionInsectMutationwild typeAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-human GALNTL5-3xHA
Plasmid#241431PurposeThe nucleotides coding human GALNTL5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (GALNTL5 Human)
Tags3xHAExpressionMammalianPromoterCAGAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 variant #1-3xHA
Plasmid#240645PurposeThe nucleotides coding mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 (37 kDa)-3xHA
Plasmid#240646PurposeThe nucleotides coding 37 kDa from the C-terminus of mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only