We narrowed to 6,267 results for: cat.2
-
Antibody#222511-rAbPurposeAnti-Glypican 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human GPC1. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceNov. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#222512-rAbPurposeAnti-Glypican 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human GPC1. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceNov. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#213673-rAbPurposeAnti-Integrin αL (Mouse) recombinant rat monoclonal antibody; binds αL subunit. For more data, see Antibody 213663.DepositorRecommended ApplicationsFlow CytometryReactivityMouseSource SpeciesRatIsotypeIgG2aTrial SizeNot available to purchaseAvailable SinceMarch 27, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#180082-rAbPurposeAnti-PSD-95 (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityHuman, Mouse, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
S17-1λpir gyrAR462C
Bacterial Strain#237425PurposeThis engineered E. coli S17-1 λpir strain, featuring a mutation in the gyrA gene (462Arg→Cys), was designed to confer resistance to the CcdB toxin, allowing it to survive with a ccdB-carrying plasmid.DepositorBacterial ResistanceNoneAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
ML12
Bacterial Strain#61910PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. ilvE avtA aspC genes deleted.DepositorBacterial ResistanceKanamycinAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only