We narrowed to 14,508 results for: SHR
-
Plasmid#220488Purposeinducible CRISPRiDepositorInsertgspeG
UseCRISPR and RNAiMutationnoneAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-bacteria_speG_E23
Plasmid#220489Purposeinducible CRISPRiDepositorInsertgspeG
UseCRISPR and RNAiMutationnoneAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g2 LentiCRISPRv2-mCherry
Plasmid#218663PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
LV-sgRNA-mCherry-Puro sgPIDD
Plasmid#211528PurposeDeletes PIDDDepositorInsertsgPIDD
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
BPK1520 sgRPS3
Plasmid#211526PurposeFacilitate knock-in of RPS3-Keima fusion proteinDepositorInsertsgRPS3
UseCRISPRExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-62
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 hygro sgUCK1
Plasmid#211524PurposeDeletes UCK1DepositorInsertsgUCK1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB4
Plasmid#197357PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-bleo-ErbB4
Plasmid#197353PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB1
Plasmid#197354PurposeA knock-out vector for dog ErbB1.DepositorInsertA gRNA targeting the dog EGFR gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB2
Plasmid#197355PurposeA knock-out vector for dog ErbB2.DepositorInsertA gRNA targeting the dog ERBB2 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-dErbB3
Plasmid#197356PurposeA knock-out vector for dog ErbB3.DepositorInsertA gRNA targeting the dog ERBB3 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCSh2-mRFP
Plasmid#170982PurposeEncodes sgRNA scaffold with mRFP in place of target and Kanamycin resistance transposon. New targets can be cloned replacing mRFP using around the horn cloning.DepositorInsertmRFP
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only