We narrowed to 7,679 results for: URE
-
Plasmid#109522PurposeMuscle specific zebrafish expression of mKate2 fused to dominant negative Dynamin2bDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only
-
actc1b-mKate2-MTM1
Plasmid#109491PurposeMuscle specific zebrafish expression of mKate2 fused to myotubularinDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19_TTE1564_UUCG-loop
Plasmid#133581PurposeT7-transcription template for a P2-deletion mutation of the Tte preQ1- riboswitchDepositorInsertP2-deletion mutant of Tte preQ1-riboswitch
UseUnspecifiedMutationreplacement of riboswitch nucleotides U6 through …PromoterT7Available SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTone-gata2aECE-EGFP
Plasmid#132974Purposegata2a endothelial enhancer (x6) and basal promoter driving egfp in pTol1 backboneDepositorInsertseGFP
gata2a endothelial enhancer (x6) with a carp b-actin basal promoter
UseUnspecified; Transposon-mediatedAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBBAD168
Plasmid#121916PurposeOth-NpuDnaBC39 inteinDepositorInsertOth-NpuDnaBC39 intein
TagsGB1-His6ExpressionBacterialMutationI111K, E116KPromoterParaAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMJA105
Plasmid#128521PurposeExpresses amyloid human Lysozyme in Pichia pastorisDepositorAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pABD933
Plasmid#67917PurposeEntry clone made prior to studies of protein co-localization of CTG10 via fluorescent fusion after transient expression in plantaDepositorInsertCTG10
UseGateway CloningAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(P46A)
Plasmid#112721PurposeThis mutation (P46A) marks the first residue within the evolved region of U1A.DepositorInsert6His-TEV-TBP6.7(P46A)
Tags6His-TEVExpressionBacterialMutationP46APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47A)
Plasmid#112722PurposeArg47 within TBP6.7 is the most critical residue in terms of forming interactions with WT TAR. Mutating this amino acid to Ala results in ~600-fold reduction in Kd.DepositorInsert6His-TEV-TBP6.7(R47A)
Tags6His-TEVExpressionBacterialMutationR47APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47K)
Plasmid#112723PurposeArg47 of TBP6.7 interacts with Hoogsteen edge of TAR's Gua26. Mutating this amino acid to Lys reduces binding to the WT TAR RNA ~330-fold.DepositorInsert6His-TEV-TBP6.7(R47K)
Tags6His-TEVExpressionBacterialMutationR47KPromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q48A)
Plasmid#112724PurposeGln48 contacts the backbone of TAR RNA as well as mediates intramoecular interaction to stabilize the conformation of beta2-beta3 loop within TBP6.7.DepositorInsert6His-TEV-TBP6.7(Q48A)
Tags6His-TEVExpressionBacterialMutationQ48APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q48T)
Plasmid#112725PurposeThis mutant of TBP6.7 binds to TAR very similarly to TBP6.7(WT), with only 1.4-fold reduced Kd.DepositorInsert6His-TEV-TBP6.7(Q48T)
Tags6His-TEVExpressionBacterialMutationQ48TPromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(T50A)
Plasmid#112727PurposeLav-evolved amino acid T50 within TBPs is important in engaging intramolecularly to steer also lab-evolved R49 into conformation compatible binding to RNA.DepositorInsert6His-TEV-TBP6.7(T50A)
Tags6His-TEVExpressionBacterialMutationT50APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(P51A)
Plasmid#112728PurposeSimilar to P46, P51 was selected and is present in all evolved TBPs. Mutating this position into Ala has a modest effect on binding.DepositorInsert6His-TEV-TBP6.7(P51A)
Tags6His-TEVExpressionBacterialMutationP51APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R52A)
Plasmid#112729Purpose52nd position is Arg in both wild-type U1A and TBPs, but the RNA recognition by this residue in both types of proteins is fundamentally different.DepositorInsert6His-TEV-TBP6.7(R52A)
Tags6His-TEVExpressionBacterialMutationR52APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q54A)
Plasmid#112730PurposeAlthough not evolved, this residue within TBPs participates in stabilizing the polypeptide loop responsible for RNA recognition.DepositorInsert6His-TEV-TBP6.7(Q54A)
Tags6His-TEVExpressionBacterialMutationQ54APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only