We narrowed to 24,060 results for: promoter
-
Plasmid#27099DepositorInsertα-Tubulin K40 acetyltransferase1 (ATAT1 Human)
TagsGFP, S-tag, and TEV siteExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3 GCN1-3xFlag_IRES-iRFP
Plasmid#198388PurposeGCN1 expressionDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_mScarlet_CLASP_RGS2membrane
Plasmid#133086PurposePlasmid contains mScarlet with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-mScarlet-yeLANS). CLASP modulates nuclear localization of mScarlet in response to blDepositorInsertmScarlet-CLASP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pM-ABE
Plasmid#196292Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding ABE in place of viral GPDepositorInsertFull length TSWV M antigenome encoding ABE in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHes7-Achilles-Hes7
Plasmid#153528PurposeExpresses fusion protein of Achilles/YFP and mouse Hes7 from mouse Hes7 promoter. The reporter shows oscillatory expression with 2-3 periodicity when expressed in mouse presomitic mesoderm.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
FHRE-Luc
Plasmid#1789PurposeReporter plasmid for FOXO3a. Forkhead responsive element with luciferase readout.DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pS-sg:GFP
Plasmid#196296Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding sgRNA:GFP fusion in place of viral NSsDepositorInsertFull length TSWV S antigenome encoding sgRNA:GFP fusion in place of viral NSs
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pM-Cas9
Plasmid#196325Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding SpCas9 in place of viral GPDepositorInsertFull length TSWV M antigenome encoding SpCas9 in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapErk)DsRed
Plasmid#200114PurposeFluorescent reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertMapErk sequence in minimal promoter
ExpressionMammalianMutationhighly modified sequencePromoter5 copies of designed MapErk sequence, no other pr…Available SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer4
Plasmid#138576PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17876439_17877752DepositorAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-YY1
Plasmid#104395PurposeHA-YY1DepositorAvailable SinceJan. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-mNeonGreen
Plasmid#162034PurposeTagged vector controlDepositorTypeEmpty backboneUseLentiviralTagsNeon GreenAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-IRES-Renilla Luciferase-IRES-Gateway-Firefly Luciferase (pIRIGF)
Plasmid#101139PurposeLuciferase reporter plasmid. Note that both renilla luciferase and ORF-firefly luciferase are encoded by a single mRNA and both are translated independently via internal ribosomal binding sites.DepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-TRIM28deltaLinker
Plasmid#124958PurposeMammalian expression of Human TRIM28 with deleted Linker region between CC and PHD domainsDepositorInserthTRIM28 (TRIM28 Human)
TagsHAExpressionMammalianMutationDeletion of linker region between CC domain and P…Available SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCutamp
Plasmid#140632PurposePlasmid-curing in Escherichia coli by targeting the AmpR promoterDepositorInsertSpCas9_lambda-RED system, SacB, Rha induction system, sgRNA targeting AmpR promoter
UseCRISPRExpressionBacterialAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-DDB1
Plasmid#19918DepositorInsertDDB1 (Damage-specific DNA binding protein 1) (DDB1 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGWB535
Plasmid#74873PurposeGateway cloning compatible binary vector for C-terminal fusion with LUC (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceOct. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLEX301-TagRFP
Plasmid#162035PurposeTagged vector controlDepositorTypeEmpty backboneUseLentiviralTagsRFPAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only