We narrowed to 25,199 results for: promoter
-
Plasmid#140380PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 14BP dowsntream from the promoterDepositorInsertT7-14BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL702
Plasmid#140372PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 0BP dowsntream from the promoterDepositorInsertT7-0BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL706
Plasmid#140376PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 6BP dowsntream from the promoterDepositorInsertT7-6BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL707
Plasmid#140377PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 8BP dowsntream from the promoterDepositorInsertT7-8BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL708
Plasmid#140378PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 10BP dowsntream from the promoterDepositorInsertT7-10BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL709
Plasmid#140379PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 12BP dowsntream from the promoterDepositorInsertT7-12BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL720
Plasmid#140390PurposeExpresses QacR-regulated 3WJdB RNA aptamer driven by T7 promoter with the qacO sequence 5BP downstream from the promoterDepositorInsertT7-qacO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL722
Plasmid#140392PurposeExpresses TtgR-regulated 3WJdB RNA aptamer driven by T7 promoter with the ttgO sequence 5BP downstream from the promoterDepositorInsertT7-ttgO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC0.055
Plasmid#119566PurposeLevel 0 part. PromoterDepositorInsertPisiAB
UseSynthetic BiologyMutationbp 391 G to A, RBS* added (22 bp) upstream of ATG…Available SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2
Plasmid#84719PurposeE. coli RecA promoter followed by stretch with no A's followed by riboswitch for single-round transcriptionDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutation12 nt stretch lacking A's inserted before 5&…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
C-term png in pGEX4
Plasmid#112975PurposeFor protein expression and purification of the C-term of Drosophila pngDepositorAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
C2 png genomic in Casper
Plasmid#112971PurposeP element vector for transposon insertion of png genomic DNA into Drosophila genomeDepositorInsertpng genomic DNA (png Fly)
UseP insertion vectorAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
C2 M2 png-myc in Casper4
Plasmid#112968PurposeP element vector for transposon insertion of Myc-tagged png into Drosophila genomeDepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET21a - Ec-ClpX D144L
Plasmid#111514PurposeExpresses E. coli ClpX with a C-terminal His tag and a mutation from D144 to L144DepositorInsertClpX
TagsHis tagExpressionBacterialMutationAspartatic acid 144 to LeucinePromoterT7Available SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC25
Plasmid#104799PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101040 (Mel1). Also expresses Cas9 from Gmubi promoter from Gmubi promoterDepositorInsertMedtr2g101040
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC24
Plasmid#104798PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101120, Medtr2g101130 (Acre2). Also expresses Cas9 from rolD promoter from AtUBQ10 promoterDepositorInsertMedtr2g101120, Medtr2g101130
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC22
Plasmid#104796PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101120, Medtr2g101130 (Acre1). Also expresses Cas9 from Gmubi promoter from AtUBQ10 promoterDepositorInsertMedtr2g101120, Medtr2g101130
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC19
Plasmid#104793PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g020630 (FmoI). Also expresses Cas9 from Gmubi promoter from Gmubi promoterDepositorInsertMedtr2g020630
UseCRISPRExpressionPlantAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDD2038
Plasmid#101378PurposeName: pBluescript-ΔRRE. Blue Heron Biotechnology Inc. bidirectional mutant variant of pBluescript-LANApi,K14 (pDD2000), RRE.DepositorInsertBlue Heron Biotechnology Inc. bidirectional mutant variant of pBluescript-LANApi,K14 (pDD2000), RRE
UseUnspecifiedMutationBlue Heron Biotechnology Inc. bidirectional mutan…Available SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only