We narrowed to 8,402 results for: 221
-
Plasmid#221614PurposeA recombinant AAV2 plasmid encoding vfChrimson-citrine with trafficking enhancement.DepositorInsertvfChrimson-citrine with membrane trafficking enhancement
UseAAVMutationvfChrimson with membrane trafficking enhancementPromoterHuman SynapsinAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-mScarlet-KV2.1
Plasmid#221617PurposeA recombinant AAV2 plasmid encoding the ZipACR I151V mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151T)-mScarlet with soma targeting
UseAAVMutationZipACR (I151T) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipV-mScarlet-KV2.1
Plasmid#221616PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151V)-mScarlet with soma targeting
UseAAVMutationZipACR (I151V) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipV-2A-IvfChr (citrine, KV2.1)
Plasmid#221618PurposeA recombinant AAV2 plasmid encoding the ZipACR I151V mutant with soma targeting with KV2.1 motif and membrane expression enhanced vfChrimson-Citrine with soma targeting KV2.1 motif.DepositorInsertZipACR (I151V)KV2.1-2A-IvfChr-citrine-Kv2.1
UseAAVMutationZipACR (I151V) with soma targeting, vfChrimson w…PromoterHuman SynapsinAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEM-601[insert(+1) TA-rich]
Plasmid#221196Purpose601 nucleosome positioning sequence with an additional base pair inserted 22 nt from the dyad on the TA-rich side of the 601DepositorInsert601[insert(+1)TA-rich]
UseUnspecifiedMutation601 has an additional mutation added 22 bp from d…Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-ScChd1[R126A/R130A]
Plasmid#221197PurposeScChd1-aa118-1274 chromatin remodeler with R126A and R130A mutationsDepositorInsertScChd1 (aa118-1274)
Tags6xHis-tag (Precission protease cleavable)ExpressionBacterialMutationR126A, R130APromoterT7Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-ScChd1[Y137A]
Plasmid#221198PurposeScChd1-aa118-1274 chromatin remodeler with Y137A mutationDepositorInsertScChd1 (aa118-1274)
Tags6xHis-tag (Precission protease cleavable)ExpressionBacterialMutationY137APromoterT7Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-ScChd1[∆ChEx]
Plasmid#221199PurposeScChd1-aa142-1274 chromatin remodeler with ChEx domain deletedDepositorInsertScChd1 (aa142-1274)
Tags6xHis-tag (Precission protease cleavable)ExpressionBacterialMutationdeleted amino acids 1-117 and 1275-1468Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(D387A eGFP)
Plasmid#221603PurposeA recombinant AAV2 plasmid encoding the light insensitive PiGM-Iq system with CRY2PHR(D387A), CIBN and EGFP as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (D387A, eGFP)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterHuman SynapsinAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Vector 1174K
Plasmid#221017PurposeFluorescent based sex separator in Anopheles species mosquitoes (SEPARATOR)DepositorInsertEngineered dobulesex splicing module (Anopheles gambiae)
UseSynthetic BiologyExpressionInsectAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTvGPI(EP)-blast-mNG
Plasmid#221051PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTvGPI(VSG)-blast-mNG
Plasmid#221050PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-TASL
Plasmid#221265PurposeExpression of TASL in mammalian cells by retroviral transductionDepositorAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-empty-GFP
Plasmid#221843Purposeempty vector to clone custom sgRNA into BsaI sites to express sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertEGFP
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGCAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-DNM1L -GFP
Plasmid#221845PurposeTol2 transposon expressing sgRNA targeting chick DNM1L from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
DNM1L sgRNA-gTGTTTTCCGACCATCCTCTG
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-MFN1-GFP
Plasmid#221846PurposeTol2 transposon expressing sgRNA targeting chick MFN1 from chick U6.3 promoter expresses GFP reporter from GAGC promoteDepositorInsertsEGFP
MFN1 sgRNA-GAGAAGAAGAGCGTCAAGGT
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-ABCC1_K684I_STOP
Plasmid#221430PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Myc-BirA*-RNF8
Plasmid#221683PurposeMammalian expression of Myc-tagged BirA*-RNF8 fusion protein for BioIDDepositorInsertRNF8 (RNF8 Human)
ExpressionMammalianAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-MAD2
Plasmid#221690PurposeMammalian expression of FLAG-tagged human MAD2DepositorInsertMAD2
ExpressionMammalianAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only