We narrowed to 2,589 results for: GCG
-
Plasmid#110736PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2DepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only
-
Circular 200,100 (GAPDH)
Plasmid#170120PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-lacZ
Plasmid#175175PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting lacZDepositorInsertsgRNA-lacZ
UseAAV and CRISPRAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
MARK4 gRNA (BRDN0001145462)
Plasmid#76727Purpose3rd generation lentiviral gRNA plasmid targeting human MARK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
INSRR gRNA (BRDN0001147393)
Plasmid#78060Purpose3rd generation lentiviral gRNA plasmid targeting human INSRRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HUNK gRNA (BRDN0001148239)
Plasmid#75940Purpose3rd generation lentiviral gRNA plasmid targeting human HUNKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-puro-hANKRD11 (exon 5-2)
Plasmid#236613PurposeKnockouts ANKRD11 in human cellsDepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP40 (pAVA3540)
Plasmid#239319PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP40DepositorInsertU6-driven sgRNA targeting RPP40 (RPP40 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP25 (pAVA3522)
Plasmid#239320PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP25DepositorInsertU6-driven sgRNA targeting RPP25 (RPP25 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-puro-hANKRD11 (exon 5-1)
Plasmid#236612PurposeKnockouts ANKRD11 in human cellsDepositorAvailable SinceJune 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A9-gRNA_(CJT87)
Plasmid#226988PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A9)DepositorInsertSpCas9 gRNA A9 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGECPL.BC10.MG
Plasmid#223822PurposeContains Cas9-editable barcode, marking guide (MG) for lineage tracing, Cre for Cas9 activation and loxP-mediated gene deletion, and Firefly Luciferase (FLuc) for live luminescence-based monitoring.DepositorInsertEf1a-Driven Cre-P2A-FLuc
UseCRISPR, Cre/Lox, Lentiviral, Luciferase, and Mous…TagsP2AExpressionMammalianPromoterEf1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZIC3_5-3)-PGKpuroBFP-W
Plasmid#211996PurposeExpress gRNA against ZIC3 with puro and BFPDepositorInsertsgRNA targeting ZIC3 (ZIC3 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZIC3_5-5)-PGKpuroBFP-W
Plasmid#211997PurposeExpress gRNA against ZIC3 with puro and BFPDepositorInsertsgRNA targeting ZIC3 (ZIC3 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TRIM25_5-2)-PGKpuroBFP-W
Plasmid#211990PurposeExpress gRNA against TRIM25 with puro and BFPDepositorInsertsgRNA targeting TRIM25 (TRIM25 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO5-SgHottip-GFP-CRISPRi
Plasmid#134989PurposedCas9-mediated inactivation of HOTTIP in mammalian cellsDepositorAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA5
Plasmid#136460PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-1-3'
Plasmid#117324PurposeCRISPR-Cas9 for miR-124-1, 3'DepositorAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
TK2 gRNA (BRDN0001149097)
Plasmid#77299Purpose3rd generation lentiviral gRNA plasmid targeting human TK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only