We narrowed to 7,001 results for: crispr cas9 plasmids
-
Plasmid#242689PurposePrime editing in mammalian cells with SpG-based PE2 prime editorsDepositorInsertpCMV-NLS-SpCas9(H840A)-M-MLV-RT(D200N,T306K,W313F,T330P,L603W)-NLS
UseCRISPRTagsNLSExpressionMammalianMutationPE2 mutations in MMLV RT, SpG mutations in SpCas9…PromoterCMVAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPEmax-Hygro
Plasmid#214020Purposeinducible PEmax system for controllable prime editing; this plasmid is used to insert PEmax prime editor in one allele of AAVS1 locusDepositorInsertPEmax
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPE2-Hygro
Plasmid#214019Purposeinducible PE2 system for controllable prime editing; this plasmid is used to insert PE2 prime editor in one allele of AAVS1 locusDepositorInsertPE2
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pL90-Nat-2xHO
Plasmid#139069PurposeCRISPR/Cas9 engineering of the HO endonuclease gene with nourseothricin selectionDepositorInsertTwo guide RNAs targeting the HO endonuclease
ExpressionBacterial and YeastPromoterTDH3Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gLacZ.hSyn.H2B.RFP
Plasmid#170369PurposeNegative control plasmid used for Crispr/cas9 based disruption. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA/EF1a-mCherry
Plasmid#114199PurposeLentivirus compatible SpCas9/dCas9 sgRNA scaffold driven by the U6 promoter and mCherry driven by the EF1a promoterDepositorInsertsgRNA scaffold
UseLentiviralTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS2601_AAV-Nme2-ABE8e-i1-U6-2xSapI
Plasmid#201683PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1 and U6 sgRNA cassette. SapI enables cloning new spacers.DepositorInsertNme2-ABE8e-i1
UseAAV and CRISPRExpressionMammalianPromoterU1aAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS2602_AAV-Nme2-ABE8e-i1(V106W)-U6-2xSapI
Plasmid#201684PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1(V106W) and U6 sgRNA cassette. SapI enables cloning new spacers.DepositorInsertNme2-ABE8e-i1 (V106W)
UseAAV and CRISPRExpressionMammalianPromoterU1aAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKm-HABE
Plasmid#170332Purposea modularized single-plasmid adenosine base editing (A-to-G) tool for Sinorhizobium melilotiDepositorInsertRhizobium codon-optimized ABEs
UseCRISPRMutationCas9n-D10AAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-PE2-His (IK1822)
Plasmid#170103PurposeT7 promoter bacterial expression plasmid for PE2 (nSpCas9(H840A)-MMLV-RT) with C-terminal 6xHis-tag and bipartite NLSDepositorInsertbpNLS-nSpCas9(H840A)-MMLVRT-bpNLS-6xHis
UseCRISPRTags6xHis tagExpressionBacterialMutationBacteria codon-optimized nSpCas9 (H840A) & M-…PromoterT7Available SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-KRAS-G12V
Plasmid#129091PurposeKI KRAS G12V mutation into human KRAS locusDepositorAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
7i sgRNA for 4-μHOM reporter
Plasmid#113626PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter 8 nts. upstream from the microhomologyDepositorInsert7i sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
7h sgRNA for 4-μHOM reporter
Plasmid#113625PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter at the edge of the microhomology.DepositorInsert7h sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-phaZ
Plasmid#169874PurposeSingle guide RNA plasmid for Cas9 targeting phaZ in P. putidaDepositorInsertsgRNA towards phaZ in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNAkan-glpR
Plasmid#169873PurposeSingle guide RNA plasmid for Cas9 targeting glpR in P. putidaDepositorInsertsgRNA towards glpR in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT42_GalL_BE-PAPAPA
Plasmid#145035PurposeExpresses BE-PAPAPA in yeast cellsDepositorInsertBE-PAPAP
UseCRISPRExpressionYeastMutationspCas9(D10A)PromoterGalLAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
ExpressionBacterial and YeastAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJT23_GalL_BE-PAPAP
Plasmid#143486PurposeExpresses BE-PAPAP in yeast cellsDepositorInsertBE-PAPAP
UseCRISPRExpressionYeastMutationspCas9(D10A)PromoterGalLAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only